e.g., " Bradi1g12*, AK424726 "


e.g., " DREB "



e.g., "IPR011046"



e.g., "protein dimerization activityBradi3g468* "

×1st. step: Input keywords

e.g., " Bradi1g195* 1000 "

×2nd. step: Choose one or multiple cis -motifs

×1st. step: Input keywords

e.g., " Bradi1g43* 3000 "

×2nd. step: Choose one or multiple cis -motifs
A

Core of AACA motifs found in rice (O.s.) glutelin genes, involved in controlling the endosperm-specific expression; AACA is also closely associated with the GCN4 motif in all rice glutelin genes and together have been shown to confer endosperm-specific enhancement to the truncated -90 CaMV 35S promoter; See also S000045, S000181, S000276;

"AACA motif" found in GluB-1 gene in rice (O.s.); Required for endosperm-specific expression; Highly conserved in the 5'-flanking region of glutelin genes; See S000277;

Sequence found in Arabidopsis (A.t.) acyl carrier protein (ACP), Acl1.2, gene promoter; Contains bZIP core motif (ACGT);

Responsive to ABA and desiccation; "Motif I" of rice rab16A-D (initially called rab-21); Expressed in seeds late during embryogenesis; Induced by ABA and osmotic stress in vegetative tissues; Contains ACGT motif; transacting factor: TAF-1;

Synthetic element (hex-3) related to response to ABA and to desiccation; seed expression; Gene: synthetic; hex-3, mutant of hex-1 sequence from wheat histone H3 promoter; transacting factor: bZIP ?;

Motif related to ABA regulation; Gene: sunflower helianthinin; transacting factor: bZIP ?

ABA regulation; seed expression; Gene: carrot Dc3; Transacting factor: bZIP ?; Contains ACGT motif;

ABF (as-1-like box binding factor) binding site; as-1-like (ASL) box is found at -98 to -79 of RTBV (rice tungro bacilliform virus) promoter; ASL box is required for phloem-specific gene expression of Rice Tungro Bacilliform Virus (RTBV); See also RNFG1OS (S000188), and RNFG2OS (S000189); See as-1 (S000023);

ABA responsive element, ABRE2, found in barley (H.v.) HVA1 gene encoding a class 3 late embryogenesis-abundant protein; stress response;

"ABRE2" of barley HVA22 gene; G-box; component of ABA response complex in HVA22 gene; see S0118 (ABRE3 of HVA22 gene); see CE1 (coupling element 1 = TGCCACCGG); See S000014;

ABA responsive element, ABRE3, found in barley (H.v.) HVA1 gene encoding a class 3 late embryogenesis-abundant protein; stress response;

"ABRE3" of barley HVA22 gene; Newly designated "A3" by Shen et al., Plant Cell 8:1107 (1996); G-box; component of ABA response complex in HVA22 gene; see S0117 (ABRE2 of HVA22 gene); see CE1 (coupling element 1 = TGCCACCGG); See S000014; ABA response complex 1(ABRC1)=A3(previously designated ABRE3)+CE1 (Shen et al., Plant Cell 8:1107(1996));

ABA-responsive element of rice (O.s.) rab16 and alpha-amylase genes;

A2 of ABRC3; ABRC3 (ABA response complex 3) of HVA1 consists of CE3 and A2; ABA responsive element; stress response; Found in barley HVA1 gene encoding a class 3 late embryogenesis-abundant (Lea) protein; ABRC1 OF HVA22 consists of CE1 and A3; CE1=S000014; A3=ABRE3=S000118; See S000118;

ABA-responsive elements (ABREs) found in the promoter of ABA and/or stress-regulated genes; ABFs, a family of ABRE binding factors; ABF3 and ABF4 function in ABA signaling; Y=C/T;

"ABRE (ABA responsive element)" in Arabidopsis (A.t.) dehydration-responsive gene rd22; R=A/G; Y=C/T;

ABA-responsive element (ABRE A) found at -148 to -139 in maize rab28 (Busk & Pages, 1997); Maize rab28 is ABA-inducible in embryos and vegetative tissues;

ABRE of napA storage-protein gene of Brassica napus (B.n.); ABA responsive element; dist B ABRE mediated transactivation by ABI3 adn ABI3-dependent response to ABA; a tetramer of the composite RY/G complex mediated only ABA-independent transactivation by ABI3; B2 domain of ABI3 is necessary for ABA-independent and ABA-dependent activation through the dist B ABRE; B3 domain of ABI3 interacts with the RY/G complex;

ABA-responsive element (ABRE B) found at -105 to -96 in maize (Z.m.) rab28 (Busk & Pages, 1997); Maize rab28 is ABA-inducible in embryos and vegetative tissues;

CE1(coupling element 1) of barley HVA22 gene; possible binding site for nuclear bZIP protein; ABA responsive complex consists of a G-box, namely ABRE3 (GCCACGTACA), and CE1;

CE3 (coupling element 3) of ABRC3 in barley HVA1 gene; ABRC3 (ABA response complex 3) of HVA1 consists of CE3 and A2; ABA responsive element; stress response; Found in barley HVA1 gene encoding a class 3 late embryogenesis-abundant (Lea) protein; ABRC1 OF HVA22 consists of CE1 and A3; CE1=S000014; A3=ABRE3=S000118; See S000118;

CE3 (coupling element 3) in maize (Z.m.) rab28 gene promoter; ABA responsive element; stress response; Similar (10 of 12) to CE3 in A1 gene of barley; See S000141 (ABRECE3HVA1); Found at -126 to -115;

"dist B (distal portion of B-box)" found in napA gene of Brassica napus (B.n.); Shows similarity to ABRE; Found between -148 and -124; Required for seed specific expression and ABA responsiveness; See S000263, S000264; dist B ABRE mediated transactivation by ABI3 adn ABI3-dependent response to ABA; a tetramer of the composite RY/G complex mediated only ABA-independent transactivation by ABI3; B2 domain of ABI3 is necessary for ABA-independent and ABA-dependent activation through the dist B ABRE;

ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;

"motif A" ABRE-like sequence found in rice (O.s.) Osem gene promoter; Essential for activation by VP1; Important for regulation by ABA; See S000102, S000300; TRAB1, bZIP transcription factor, interacts with VP1 and mediates abscisic acid-induced transcritption;

"Motif III" found in the promoter of rice (O.s.) rab16B gene; Motif I (S000290) and motif III are both required for ABA responsiveness; However, each can substitute for the other;

"Motif I" found in the promoter of rice (O.s.) rab16B gene; Motif I and motif III (S000291) are both required for ABA responsiveness; However, each can substitute for the other; See S000019, S000120;

"ABA responsive element (ABRE)" of wheat Em and rice (O.s.) rab21 genes; Proposed consensus sequence for the repeated motif (Em1a and Em1b) of wheat Em gene; S=C/G;

"ABRE-related sequence" or "Repeated sequence motifs" identified in the upstream regions of 162 Ca(2+)-responsive upregulated genes; see also ABRE; M=C/A; Y=T/C; B=T/C/G;

"ABRE (ABA responsive element)" found in wheat (T.a.) Em gene; transacting factor: EMBP-1; EMBP-1 binds to CACGTGGC; See S000119 EMBP1;

ABRE; ABA and water-stress responses; Found in maize (Z.m.) rab28; maize rab28 is ABA-inducible in embryos and vegetative tissues; Found in the Arabidopsis (A.t.) alcohol dehydrogenase (Adh) gene promoter; "ABRE2"; Found in the maize (Z.m.) Cat1 gene promoter; Responsible for the induction by ABA; Binding site of CBF2; Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance; The CBF genes do not appear to be autoregulated through the CRT/DRE sequence;

"ACEAtCHS (ACGT containing element)" found in the LRU (light-responsive unit) in Arabidopsis (A.t.) chalcone synthase (CHS) gene promoter; Required for UV-B and UV-1/blue light responsiveness; See S000356; Transcriptional repression by AtMYB4 controls production of UV-protecting sun screens in Arabidopsis; AtMYB4 mutant shows enhanced levels of sinapate ester in leaves and tolerance of UV-B irradiation; AtMYB4 expression is downregulated by exposure to UV-B light;

"A-box" according to the nomenclature of ACGT elements by Foster et al. (FASEB J 8:192-200 (1994)); One of ACGT elements; Found in ocs gene; RITA-1 binding site (Izawa et al. 1994); "G motif" by Toyofuku et al. (1998); G motif and TATCCAY motif (a GATA motif as its antisense sequence; see S000256) are responsible for sugar repression (Toyofuku et al. 1998); See S000346;

Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;

"ABRE motif A" found in the promoter of the rice (O.s.) Osem gene; ACGT-containing ABRE; Required for ABA-responsiveness and VP1 activation; Binding site of TRAB1; Motif A and CE3 (S000282) are functionally equivalent; TRAB1, bZIP transcription factor, interacts with VP1 and mediates abscisic acid-induced transcritption;

ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;

"C-box" according to the nomenclature of ACGT elements by Foster et al. (FASEB J 8:192-200 (1994)); One of ACGT elements; Factors groups 1, 2 and 3 have affinity for C-box (Izawa et al. J Mol Biol. 230:1131-1144 (1993)); RITA-1 binding site (Izawa et al. 1994);

"ACGT motif" found in GluB-1 gene in rice (O.s.); Required for endosperm-specific expression; Conserved in the 5'-flanking region of glutelin genes; See S000276, S000277; See S000019;Combination of GCN4, AACA and ACGT motifs was found sufficient to confer a detectable level of endosperm expression; See S000353, S000354;

"ACGT motif" related to root expression; Gene: synthetic; perfect palindromic sequence (PA) containing G-box-related sequence; transacting factor: TAF-1 ?; Binding of SGBF-1 (a Soybean G-box binding bZIP transcription factor) to ABRE is enhanced by SCOF-1 (a zinc finger protein ); Transcription of SCOF-1 is induced by low temperature and ABA;

"ACGT motif" related to seed expression; Gene: French bean phaseolin; transacting factor: 02;

"ACGT motif" related to seed expression; Gene: synthetic; wild-type motif (Iwt) containing G-box-related sequence; transacting factor: bZIP ?; A tobacco bZip transcription activator (TAF-1) binding site;

"T-box" according to the nomenclature of ACGT elements by Foster et al. (FASEB J 8:192-200 (1994)); One of ACGT elements; See also ACGTABOX (S000130), ACGTCBOX (S000131), and CACGTGMOTIF (S000042);

ACIII element found at -246 to -238 of bean (P.v.) PAL2 promoter; ACIII element is required for vascular-specific gene expression; See also ACIPVPAL2 (S000192) and ACIIPVPAL2 (S000193); Three AC-elements, which are possible Myb protein binding sites, together with a G-box, interact to direct the complex patterns of tissu-specific expression of pAL2 gene;

ACII element found at -131 to -120 of bean (P.v.) PAL2 promoter; ACII element is required for vascular-specific gene expression; See also ACIPVPAL2 (S000192) and ACIIIPVPAL2 (S000194); Three AC-elements, which are possible Myb protein binding sites, together with a G-box, interact to direct the complex patterns of tissu-specific expression of pAL2 gene;

ACI element found at -83 to -74 of bean (P.v.) PAL2 promoter; AC-rich element; ACI element is required for vascular-specific gene expression; See also ACIIPVPAL2 (S000193) and ACIIIPVPAL2 (S000194); Three AC-elements, which are possible Myb protein binding sites, together with a G-box, interact to direct the complex patterns of tissue-specific expression of pAL2 gene;

Binding consensus sequence of Arabidopsis (A.t.) AGAMOUS MADS domain; MCM1 binding-sites in a-mating-type-specific promoters of Saccharomyces cerevisiae show similarities with the binding-site sequence of the AGAMOUS MADS domain; See S000316; MADS domain and I region of AGAMOUS are sufficient and necessary for DNA binding; Both the K domain and C region are indispensable for AG function in flower development; See S000338;

Binding consensus sequence for the product of the Arabidopsis (A.t.) floral homeotic gene AGAMOUS (AG); AG protein contains a region similar to the DNA binding domain of SRF and MCM1; The consensus sequence contains a CArG box; AG protein is a putative transcription factor for floral genes; H=A/T/C; W=A/T; See S000342; MADS domain and I region of AGAMOUS are sufficient and necessary for DNA binding; Both the K domain and C region are indispensable for AG function in flower development; See S000338;

"AGC box" repeated twice in a 61 bp enhancer element in tobacco (N.p.) class I beta-1,3-glucanase (GLB) gene; See S000036, S000089; "GCC-box"; Binding sequence of Arabidopsis AtERFs; AtERF1,2 and 5 functioned as activators of GCC box-dependent transcription; AtERF3 and 4 acted as repressors; AtERF proteins are stress signal-response factors; EREBP2 binding site; Conserved in most PR-protein genes; Rice MAPK (BWMK1) phosphorylates OS EREBP1, which enhance DNA-binding activity of the factor to the GCC box;

Binding consensus sequence of Arabidopsis (A.t.) AGL1 (AGAMOUS-like 1); AGL1 contains MADS domain; See S000339; AGL20 is a MADS domain gene from Arabidopsis that is activated in shoot apical meristem during the transition to flowering; AGL20 is also regulated by the Gibberellin pathway; Complex regulatory net works involving several MADS-genes underlie development of vegetative structures;

Binding consensus sequence of Arabidopsis (A.t.) AGL2 (AGAMOUS-like 2); AGL2 contains MADS domain; AGL2 binds DNA as a dimer; See S000338;

Binding consensus sequence of Arabidopsis(A.t.) AGL3; AGL3 is MADS-box domain protein; AGL3 is expressed in all above-ground vegetative organs; AGL3 may be involved the transcriptional regulation of genes;

AG-motif found at -114 of the promoter of NtMyb2 gene; NtMyb2 is a regulator of the tobacco retrotransposon Tto1 and the defence-related gene phenylalanine ammonia lyase (PAL), which are induced by various stress such as wounding or elicitor treatment; AGP1 (GATA-type zinc finger protein) binding site;

"AGTA repeat" in pumpkin (C.s.) ascorbate oxidase gene (AO) promoter; Found in silencer region; AOBP (AGTA repeat binding protein) binding site; AOBP protein has DOF domain; Required for repression of expression of AO gene;

"ALF-1 (as-1-like sequence binding factor)" binding site found in tobacco (N.t.) parC gene; Found in auxin-responsive regions; as-1-like sequences in parA, parB and parC bind with ASF-1, ALF-2, and ALF-1, respectively; See S000190 (ABFOS);

"ALF-2 (as-1-like sequence binding factor 2)" binding site found in tobacco (N.t.) parB gene; Found in auxin-responsive regions; as-1-like sequences in parA, parB and parC bind with ASF-1, ALF-2, and ALF-1, respectively; See S000190 (ABFOS);

Motifs (IIU and IID) found in the Chlamydomonas (C.R.) Nia1 gene promoter; Involved in ammonium-response; Located between -231 and -219 and also between -76 and -65; Involved in Nia1 transcription activation; W=T/A;

Motif (IVD) found in the Chlamydomonas (C.R.) Nia1 gene promoter; Located between -51 and -42; Involved in Nia1 transcription repression;

Motif (VD) found in the Chlamydomonas (C.R.) Nia1 gene promoter; Located between -33 and -8; Involved in Nia1 transcription activation;

"amylase box"; Conserved sequence found in 5'-upstream region of alpha-amylase gene of rice, wheat, barley;

"amylase box"; "amylase element"; Conserved sequence found in 5'upstream region of alpha-amylase gene of rice, wheat, barley; "amylase box" (Huang et al. 1990); "amylase element" (Hwang et al., 1998);

One of 16 motifs found in silico in promoters of 13 anaerobic genes involved in the fermentative pathway (anaerobic set 1)(Mohanty et al., 2005); Arbitrary named ANAERO1CONSENSUS by the PLACEdb curator; See also S000478, S000479, S000480, S000481;

One of 16 motifs found in silico in promoters of 13 anaerobic genes involved in the fermentative pathway (anaerobic set 1)(Mohanty et al., 2005); Arbitrary named ANAERO2CONSENSUS by the PLACEdb curator; See also S000477, S000479, S000480, S000481;

One of 16 motifs found in silico in promoters of 13 anaerobic genes involved in the fermentative pathway (anaerobic set 1)(Mohanty et al., 2005); Arbitrary named ANAERO3CONSENSUS by the PLACEdb curator; See also S000477, S000478, S000480, S000481;

One of 16 motifs found in silico in promoters of 13 anaerobic genes involved in the fermentative pathway (anaerobic set 1)(Mohanty et al., 2005); Arbitrary named ANAERO4CONSENSUS by the PLACEdb curator; See also S000477, S000478, S000479, S000481; H=A/T/C;

One of 16 motifs found in silico in promoters of 13 anaerobic genes involved in the fermentative pathway (anaerobic set 1)(Mohanty et al., 2005); Arbitrary named ANAERO5CONSENSUS by the PLACEdb curator; See also S000477, S000478, S000479, S000480;

20 bp anaerobic cis-regulatory sequence found in the maize (Z.m.) GapC4 (Glyceraldehyde-3-phosphate dehydrogenase 4) gene promoter; Located between -286 and -266; Required for anaerobic gene expression in transgenic tobacco; See S000351;

"ARE (antioxidant response element)"; antioxidant response element of rat glutathione S-transferase Ya subunit, and rat NAD(P)H:quinone reductase genes;

Putative binding site for a Myb found in the promoter of maize glycolytic glyceraldehyde-3-phospate dehydrogenase 4 (GapC4) gene; Essential for anaerobic induction;

Sequence highly similar to ARE (anthocyanin regulatory element) found in maize anthocyanin promoter (Tuerck and Fromm 1994; Lesnick and Chandler 1998); Binding site of R2R3-type MYB factor, GMYB 10 of G. hybrida;

ARF (auxin response factor) binding site found in the promoters of primary/early auxin response genes of Arabidopsis thaliana (A.t.); AuxRE; See S000337; Binding site of Arabidopsis ARF1 (Auxin response factor1); Sequence found in NDE element in Soybean (G.m.) SAUR (Small Auxin-Up RNA) 15A gene promoter; See S000359, S000360; Found in D1 or D4 element in Soybean (G.m.) GH3 promoter; This element was enriched in the 5'-flanking region of genes up-regulated by both IAA and BL (Goda et al., 2004);

"ARR1-binding element" found in Arabidopsis; ARR1 is a response regulator; N=G/A/C/T; AGATT is found in the promoter of rice non-symbiotic haemoglobin-2 (NSHB) gene (Ross et al., 2004);

"as-1 (activation sequence 1)" in CaMV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea and tobacco; Expression in root and leaf;

as-1-like motif found in cucumber (C.s.) hydroxypyruvate reductase (hprA) gene; Required for cytokinin responsiveness; Also see S000261 (CYTOSITECSHPRA);

Tobacco ASF-1 binding site in nopaline synthase (NOS) promoter of Ti-plasmid of Agrobacterium tumefaciens (A.t.); From -131 to -111; See S000312; Containing two hexamer motifs; Essential for the nos promoter activity;

"ASF-1 binding site" in CaMV 35S promoter; ASF-1 binds to two TGACG motifs; See S000023 (AS1); Found in HBP-1 binding site of wheat histone H3 gene; TGACG motifs are found in many promoters and are involved in transcriptional activation of several genes by auxin and/or salicylic acid; May be relevant to light regulation; Binding site of tobacco TGA1a; TGA1a and b show homology to CREB; TGA6 is a new member of the TGA family; Abiotic and biotic stress differentially stimulate "as-1 element" activity;

"ASF-1 (as-1 binding nuclear factor)" binding site found in tobacco (N.t.) parA gene; Found in auxin-responsive regions; as-1-like sequences in parA, parB and parC bind with ASF-1, ALF-2, and ALF-1, respectively; See S000190 (ABFOS), S000238 (ALF1NTPARC), S000239 (ALF2NTPARB);

"AT-1 box (AT-rich element)" found in the promoter region of the genes for tobacco ( N.p.) chlorophyll a/b binding protein (cab) and small subunit of ribulose-1,5-bisphosphate carboxylase (rbcS); Deletion of a region containing the AT-1 site in the tomato RBCS3A gene strongly inhibited reporter gene expression, whereas AT-1 site in N. plumbaginifolia CAB gene (cab-E) is in a negative element (Terzaghi & Cashmore, 1995);

Recognition sequence of Arabidopsis Athb-1 protein; Athb-1 protein has a HD-Zip motif (homeodomain (HD) with a closely linked leucine zipper motif (Zip)); HD-Zip domain binds to DNA as a dimer; See S000318; W=A/T;

Recognition sequence of Arabidopsis Athb-2 protein; Athb-2 protein has a HD-Zip motif (homeodomain (HD) with a closely linked leucine zipper motif (Zip)); See S000317; S=C/G;

Consensus binding sequence for Arabidopsis (A.T.) class I HDzip (Homeodomein-leucine zipper) protein, ATHB5; ATHB5 protein forms dimers in solution; ATHB5 and ATHB6 exhibit identical DNA binding specificities; ATHB5 forms heterodimers with other class I HDzip proteins; See also S000475;

Consensus binding sequence for Arabidopsis (A.T.) homeodomain-leucine zipper protein, ATHB6; ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses; See S000371;

A/T-rich sequences found in pea (P.s.) plastocyanin gene (petE) promoter; Act as quantitative enhancer; Found at -289 to -255 of pea PetE gene;

"AuxRE (Auxine responsive element )" of pea (P.s.) PS-IAA4/5 gene; Indoleacetic acid-inducible genes; domain A; TGA1a is preferentially expressed in root tip meristems; TGA1a may contribute to the expression of GST isoenzymes, especially in root tip meristems;

"TGA-box #1" in putative auxin-resonsive element (AUXRE) of soybean (G.m.) GH3 promoter; Strong binding site for proteins in plant nuclear extracts;

"TGA-box #2" in putative auxin-resonsive element (AUXRE) E1 of soybean (G.m.) GH3 promoter; Strong binding site for proteins in plant nuclear extracts; Hex-like element; E1 element=-249 to -203; E2 element=-241 to -224; Called G-box by Liu et al. (1997);
B

"B2"; DNase I protected sequence found in the soybean (G.m.) auxin responsive gene, Aux28, promoter; Located between -310 and -301; Contains a TGACGACA sequence which is similar to TGACGT/C sequence found in Ocs, CaMV35S and histone H3 promoter; Contains as-1 motif;

"10 base pair motif (site 1)" within the B-box found in the potato patatin gene promoter; Involved in potato tuber-specific and sucrose-inducible gene expression; Storekeeper (STK) binds to this region and regulates patatin expression in potato;

Binding site of OsBIHD1, a rice BELL homeodomain transcription factor;

Box 1 element in pea (P.s.) glutamine synthetase (GS2) gene; An element in a 33-bp AT-rich sequence (box 1) of the 5' end of a GS2 promoter; Located at -837 to -827 of pea GS2; Multimer of box 1 element was used to isolate a cDNA encoding an AT-rich DNA binding protein (ATBP-1) (Tjaden & Coruzzi, 1994);

Box 1 of bean (P.v.) chs15 promoter; one of SBF-1 binding sites in chs15 promoter; Located at -318 to -305; Involved in organ-specific expression in plant development; Functions as a transcriptional silencer in electroporated protoplasts derived from undifferentiated suspension-cultured soybean cells; Resemble the binding site for the GT-1 factor in light-responsive elements; For a compilation of related GT elements and factors, see Villain et al. (1996);

Box 2 in glutamine synthetase (GS2) gene in pea (P.s.); Repeated in tandem with a partial palindrome located between the repeats; Located at ca. -300 of pea GS2;

Box 2 of bean (P.v.) chs15 promoter; SBF-1 binding site; For a compilation of related GT elements and factors, see Villain et al. (1996);

Box 3 of bean (P.v.) chs15 promoter; SBF-1 binding site; For a compilation of related GT elements and factors, see Villain et al. (1996);

Box B in pea (P.s.) asparagine synthetase (AS1) gene; Found at -61; AS1 is negatively regulated by light; Box B binds with nuclear proteins;

Box C' in pea asparagine synthetase (AS1) gene; Found at -88; AS1 is negatively regulated by light; Box C' binds with nuclear proteins, which was competed by a putative repressor element RE1 (see S000195);

Box C in pea (P.s.) asparagine synthetase (AS1) gene; Found at -45; AS1 is negatively regulated by light; Box C binds with nuclear proteins, which was competed by a putative repressor element RE1 (see S000195);

"Box I consensus sequence in the promoters of mustard and parsley chs genes; Essential for light regulation (Terzaghi & Cashmore, 1995); M=A/C;

"Box II" found in the tobacco (N.t.) plastid atpB gene promoter; Conserved in several NCII (nonconsensus type II) promoters of plastid genes; Important for the activity of this NCII promoter; See S000295;

Core of "Box II/G box" found in the parsley (P.c.) chs genes; Essential for light regulation (Terzaghi & Cashmore, 1995); See S000345;

"Box I" found in the tobacco (N.t.) plastid atpB gene promoter; Conserved in several NCII (nonconsensus type II) promoters of plastid genes; Important for the activity of this NCII promoter; See S000296;

Consensus of the putative "core" sequences of box-L-like sequences in carrot (D.c.) PAL1 promoter region; DCMYB1 bound to these sequences in vitro; See also S000136 (Box P), S000137 (Box A), S000138 (Box L); W=A/T;

OsBP-5 (a MYC protein) binding site in Wx promoter;

"BS1 (binding site 1)" found in E. gunnii Cinnamoyl-CoA reductase (CCR) gene promoter; nuclear protein binding site; Required for vascular expression;
C

"C1"; DNase I protected sequence found in the soybean (G.m.) auxin responsive gene, Aux28, promoter; Located between -463 and -448; A/T-rich sequence;

"C1-motif"; Similar to Myb-box; Found in the promoter region of maize (Z.m.) Bronze2 ( glutathione S-transferase) gene; C1 binding; C1-motif and R-motif were shown to be important for full R and C1 activation of the Bz2 promoter; S=C or G;

"C2"; DNase I protected sequence found in the soybean (G.m.) auxin responsive gene, Aux28, promoter; Located between -552 and -553; Contains (ATT)4 sequence;

"CAAT promoter consensus sequence" found in legA gene of pea;

"CAAT box" found in the 5' upstream region (-80) of many eukaryotic genes; GGC(or T)CAATCT;

Sequence found in D4 element in Soybean (G.m.) GH3 gene promoter; Showed constitutive activity with TGTCTC element (See S000270); Confers auxin inducibility; Binding site of nuclear protein; See also S000369;

"CACGTG motif"; "G-box"; Binding site of Arabidopsis GBF4; C. roseus G-box binding factor 1 (CrGBF1) and 1 (CrGBF2) can act as transcriptional repressors of the Str promoter via direct interaction with the G-box; See S000345; Essential for expression of beta-phaseolin gene during embryogenesis in bean, tobacco, Arabidopsis; Tomato Pti4 (ERF) regulates defense-related gene expression via GCC box and non-GCC box cis-element (Myb1 (GTTAGTT) and G-box (CACGTG));

Tetranucleotide (CACT) is a key component of Mem1 (mesophyll expression module 1) found in the cis-regulatory element in the distal region of the phosphoenolpyruvate carboxylase (ppcA1) of the C4 dicot F. trinervia; Y=T/C;

Core of "(CA)n element" in storage protein genes in Brasica napus (B.n.); embryo- and endosperm-specific transcription of napin (storage protein) gene, napA; seed specificity; activator and repressor;

"CAREs (CAACTC regulatory elements)" found in the promoter region of a cystein proteinase (REP-1) gene in rice;

"CArG1" found in the Arabidopsis (A.t.) APETALA3 (AP3) gene promoter; Binding site of AP3/PI heterodimer; Binding site of AP3/PI heterodimer; Binding site for a positively acting factors; MADS domain transcription factors bind with a consensus sequence called the CArG box; See S000348, S000349;

"CArG2" found in the Arabidopsis (A.t.) APETALA3 (AP3) gene promoter; Mutations in CArG2 result in a decrease in the expression in petals, but the expression pattern in stamens is unchanged; See S000348, S000349;

"CArG3" found in the Arabidopsis (A.t.) APETALA3 (AP3) gene promoter; Binding site of AP3/PI heterodimer; Binding site for a negatively acting factors; Binding sequence of Arabidopsis (A.t.) MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS; AP1, AG, and AP3-PI complexes induce similar conformational changes on a CArG-box sequence; See S000347, S000348, S000338;

"CArG consensus" sequence found in the promoter of Arabidopsis (A.t.) SOC1 which is the MADS-box flowering-time gene; FLC is a component of the vernalization (low-temperature) pathway binds directly to this site and blocks transcriptional activation of SOC1 by CONSTANS (CO); See also S000342 (AGAMOUSATCONSENSUS); W=A/T;

A variant of CArG motif (see S000404), with a longer A/T-rich core; Binding site for AGL15 (AGAMOUS-like 15); W=A/T;

Noncanonical CArG motif (CC-Wx8-GG) found in the promoter region of DTA1 (AtGA2ox6); A relevant cis element for the response to AGL15 (AGAMOUS-like 15) in vivo; W=A/T; See S000431 (C-Wx8-G), S000404 (CArG consensus; CC-Wx6-GG);

Sequence found in NDE element in soybean (G.m.) SAUR (Small Auxin-Up RNA) 15A gene promoter; Involved in auxin responsiveness; See S000359, S000360;

Binding site of barley (H.v.) CBF1, and also of barley CBF2; CBF = C-repeat (CRT) binding factors; CBFs are also known as dehydration-responsive element (DRE) binding proteins (DREBs); See also S000411 (SQ=GTCGAC); R=A/G; Y=C/T;

CCA1 binding site; CCA1 protein (myb-related transcription factor) interact with two imperfect repeats of AAMAATCT in Lhcb1*3 gene of Arabidopsis thaliana (A.t.); Related to regulation by phytochrome;

Common sequence found in the 5'-non-coding regions of eukaryotic genes; "CCAAT box" found in the promoter of heat shock protein genes; Located immediately upstream from the most distal HSE of the promoter; "CCAAT box" act cooperatively with HSEs to increase the hs promoter activity;

Sequence found in D1 element in Soybean (G.m.) GH3 gene promoter; Showed constitutive activity with TGTCTC element (See S000270); Confers auxin inducibility; Binding site of nuclear protein; See also S000368;

CDA-1 (CAB2 DET1-associated factor 1) binding site in DtRE (dark response element) f of chlorophyll a/b-binding protein2 (CAB2) gene in Arabidopsis;

"CE3 (Coupling Element 3)" found in the promoter of the rice (O.s.) Osem gene; Required for ABA-responsiveness and VP1 activation; Binding site of TRAB1; Motif A and CE3 (S000281) are functionally equivalent; TRAB1, bZIP transcription factor, interacts with VP1 and mediates abscisic acid-induced transcritption;

"cell cycle box" found in URS2 (-940/-200) of HO gene of S.cerevisiae; cell-cycle-specific activation of transcription;

"cereal glutenin box" in pea legumin gene (legA); sequence homologous to the cereal glutenin gene control element ("-300 element");

"cereal glutenin box" in pea legumin gene (legA); sequence homologous to the cereal glutenin gene control element ("-300 element");

"cereal glutenin box" in pea (P.s.) legumin gene (legA); sequence homologous to the cereal glutenin gene control elements;

"CGACG element" found in the GC-rich regions of the rice (O.s.) Amy3D and Amy3E amylase genes, but not in Amy3E gene; May function as a coupling element for the G box element;

"CGCG box" recognized by AtSR1-6 (Arabidopsis thaliana signal-responsive genes); Multiple CGCG elements are found in promoters of many genes; Ca++/calmodulin binds to all AtSRs; V=A/C/G; B=G/T/C;

CGF-1 binding site in the Arabidopsis (A.t.) cab2 gene promoter; CGF-1=CAB GATA Factor 1; Found at -74 to -42; Contains a highly conserved, repeated GATA motif termed I-box (see S000124, S000199); For GATA motif, see S000039; The binding specificity of CGF-1 appears to be related to GT-family of DNA-binding proteins; For a compilation of related GT elements and factors, see Villain et al. (1996);

Sequence found in the maize (Z.m.) C1 gene promoter; Located between -147 to -132; Containing Sph element; Required for ABA responsiveness; See S000154, S000293;

Region necessary for circadian expression of tomato (L.e.) Lhc gene;

CMSRE-1 (Carbohydrate Metabolite Signal Responsive Element 1) found in the promoter of sweet potato (I.b.) sporamin A gene;

Conserved 11 nt sequence found in the maize (Z.m.) mitochondrial atp1 promoter; Located between -5 and +6; Essential for the expression;

CORE (coordinate regulatory element for antioxidant defense) conserved on the promoter regions of three antioxidant defense genes in rice: cytosolic superoxide dismutase, cytosolic thioredoxin, and glutaredoxin; K=T/G; W=T/A; Y=T/C; R=A/G; M=C/A;

The sequence critical for Cytokinin-enhanced Protein Binding in vitro, found in -490 to -340 of the promoter of the cucumber (CS) POR (NADPH-protochlorophyllide reductase) gene;

"ACE"; Binding site of parsley (P.c.) bZIP factors CPRF1 and 4; Found in the parsley (P.c.) light responsive chalcone synthase (CHS) gene promoter; The proline-rich domains of CPRF1 and 4 activate transcription; CPRF1-containing bZIP heterodimer interacts with ACE in vivo;

"BoxII"; Binding site of CPRF-1, -2, -3 and -4(Common Plant Regulatory Factor) in the parsley (P.c.) light responsive chalcone synthase (CHS) gene promoter; CPRF proteins are bZIP class transcription factors; CPRF proteins participates in the light-mediated activation of the CHS gene in parsley; "ACE"; The proline-rich domains of CPRF1 and 4 activate transcription; CPRF1-containing bZIP heterodimer interacts with ACE in vivo;

Preferred sequence for AP2 transcriptional activator HvCBF2 of barley; "Core CRT/DRE motif"; HvCBF2 bound to a (G/a)(T/c)CGAC core motif (Xue, 2003); DNA binding is regulated by temperature; This motif was erroneously ID-labeled in PLACEdb as CDTDREHVCBF2, and was corrected on 22 June, 2006;

CT-rich motif (inverted GAGA) found in a 60-nucleotide region (S1) downstream of the transcription start site of the CaMV 35S RNA; Can enhance gene expression; Inverted GAGA; See also S000405, S000427 (GAGA); (TC)4T;

GTAC is the core of a CuRE (copper-response element) found in Cyc6 and Cpx1 genes in Chlamydomonas; Also involved in oxygen-response of these genes; For CuRE, see Quin and Merchant, 1995;

13 bp sequence of unknown function found in cucumber (C.s.) hydroxypyruvate reductase (hprA) gene promoter; Protein binding site; Required for cytokinin responsiveness; See S000260 (AS1LIKECSHPRA) found in the same region; Also involved in light responsiveness; see also S000260;
D

"D1"; DNase I protected sequence found in the soybean (G.m.) auxin responsive gene, Aux28, promoter; D1 and D4 share a very similar core sequence TAGTXXCTGT and TAGTXCTGT, respectively; D1/D4-like sequence were identified in several other auxin-responsive genes; Binding site of GmGT-2 which is the GT-2 family of transcription factors; GmGT-2 are down-regulated by light in a phytochrome-dependent manner; See 000331;

"D2"; DNase I protected sequence found in the soybean (G.m.) auxin responsive gene, Aux28, promoter; Located between -703 and -716; A/T-rich sequence;

"D3"; DNase I protected sequence found in the soybean (G.m.) auxin responsive gene, Aux28, promoter; Located between -750 and -760; A/T-rich sequence;

"D4"; DNase I protected sequence found in the soybean (G.m.) auxin responsive gene, Aux28, promoter; D1 and D4 share a very similar core sequence TAGTXXCTGT and TAGTXCTGT, respectively; D1/D4-like sequence were identified in several other auxin-responsive genes; See 000328;

"DE1" found in the pea(P.S) pra2 gene promoter; Involved in pra2 down-regulation by phytochrome A, phytochrome B and blue-light photoreceptors; pra2 encodes a small GTPase belonging to the YPT/rab family; DF1 has DNA-binding domain specifically binds to two types of DNA sequences, DE1 and GT2;

Core site required for binding of Dof proteins in maize (Z.m.); Dof proteins are DNA binding proteins, with presumably only one zinc finger, and are unique to plants; Four cDNAs encoding Dof proteins, Dof1, Dof2, Dof3 and PBF, have been isolated from maize; PBF is an endosperm specific Dof protein that binds to prolamin box; Maize Dof1 enhances transcription from the promoters of both cytosolic orthophosphate kinase (CyPPDK) and a non-photosynthetic PEPC gene; Maize Dof2 supressed the C4PEPC promoter;

A novel class of bZIP transcription factors, DPBF-1 and 2 (Dc3 promoter-binding factor-1 and 2) binding core sequence; Found in the carrot (D.c.) Dc3 gene promoter; Dc3 expression is normally embryo-specific, and also can be induced by ABA; The Arabidopsis abscisic acid response gene ABI5 encodes a bZIP transcription factor; abi5 mutant have a pleiotropic defects in ABA response; ABI5 regulates a subset of late embryogenesis-abundant genes; GIA1 (growth-insensitivity to ABA) is identical to ABI5;

"DR5"; A highly active synthetic auxin response element; Created by site-directed mutations in a natural composite AuxRE found in the soybean GH3 promoter; The DR5 showed greater auxin responsiveness; Binding site of ARF1; See S000270;

"DRE1" core found in maize (Z.M.) rab17 gene promoter; "DRE1" was protected, in in vivo footprinting, by a protein in embryos specifically, but in leaves, was protected when was treated with ABA and drought; rab17 is expressed during late embryogenesis, and is induced by ABA; See S000150, S000200 and S000402;

"DRE2" core found in maize (Z.M.) rab17 gene promoter; "DBF1" and "DBF2" bound to "DRE2"; rab17 is expressed during late embryogenesis, and is induced by ABA; See S000150, S000200 and S000401;

Core motif of DRE/CRT (dehydration-responsive element/C-repeat) cis-acting element found in many genes in Arabidopsis and in rice; R=G/A; Os DREB1A bound to GCCGAC more preferentially than to ACCGAC whereas At DREB1A bound to both GCCGAC and ACCGAC efficiently; See S000402 (ACCGAC); Maize ZmDREB1A bound to DRE (Qin et al. 2004); HaDREB2 in Helianthus annuus (sunflower)(Diaz-Martin et al. 2005);

Related to responsiveness to drought, low-temperature or high-salt stress; See S000153, S000157; Binding site of DREB1 and DREB2: Binding site of Arabidopsis CBF1(C-repeat/DRE binding factor); Overexpression of DREB1A activated the expression of stress tolerance genes; CBF1 overexpression induces COR genes and enhances freezing tolerance; Heterologous CBF1 expression enhances oxidative stresses tolerance; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis;
E

"re2f-1" found in the promoter of rice PCNA gene; Located between -142 and -135; "te2f-1" found in the promote of Tobacco PCBA gene; Located between -122 and -115; Binding site of OsE2F1 and OsE2F2; Involved in transcriptional activation in actively dividing cells and tissue;

"E2Fa element" found in the tobacco (N.t.) RNR (Ribonucleotide reductase) gene promoter and in the Arabidopsis thaliana (A.t.) CDC6 gene promoter; Binding site of tobacco and Arabidopsis E2F; Involved in upregulation of the promoter at G1/S transition; See S000367;

"E2F-binding site" found in many potential E2F target genes; most potential E2F targets identified in silico show a cell cycle-regulated expression; Y=T/C; see S000366;

"E2Fb" found in the tobacco (N.t.) RNR (Ribonucleotide reductase) gene promoter; Binding site of tobacco E2F; Involved in upregulation of the promoter at G1/S transition; See S000366; "dE2F (distal reverse E2F element)" important for regulating specific RNR1a gene expression in respsonse to UV-C irradiation; See S000455;

"E2F consensus sequence" of all different E2F-DP-binding motifs that were experimentally verified in plants (Vandepoele et al., 2005); See also S000417, S000397, S000396, S000367, S000366; W=A/T; S=C/G;

E-box of napA storage-protein gene of Brassica napus (B.n.); See S000042 (CACGTGMOTIF); see S000407 (Myc consensus: CANNTG); This sequence is also known as RRE (R response element)(Hartmann et al., 2005);

"EEC"; Consensus motif of the two enhancer elements, EE-1 and EE-2, both found in the promoter region of the Chlamydomonas Cah1 (encoding a periplasmic carbonic anhydrase); Binding site of Myb transcription factor LCR1 (see Yoshioka et al, 2004); N=A/G/C/T;

EIN3 (Ethylene-insensitive 3) binding site found in the promoter of the Arabidopsis (A.t.) ERF1 (Ethylene-Response-Factor 1); EIN3 recognizes its target as a homodimer; EIN3 is necessary and sufficient for ERF1 expression; Consititutive expression of ERF1 results in the activation of a variety of ethylene response genes and phenotype; ERF1 is a GCC-box binding site; ERF1 acts downstream of EIN3;

"Element 1" found in the promoter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Located at -223 to -246; Element 1 and Element 2 (S000320) bind to the same nodule specific factor; Element 1 and Element 2 share a common motif; See S000320;

"Element 2" found in the promoter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Located at -161 to -176; Element 1(S000319) and Element 2 (S000320) bind to the same nodule specific factor; Element 2 is highly conserved in other soybean lb gene promoter regions; See S000319;

One of two elicitor (ELRE) and light response elements (LRE) found in the parsley (P.c.) phenylalanine ammonia-lyase (PAL-1) gene promoter; Involved in UV light and elicitor responsiveness; Conserved in several elicitor or light-responsive genes; See S000307;

One of two elicitor (ELRE) and light response elements (LRE) found in the parsley (P.c.) phenylalanine ammonia-lyase (PAL-1) gene promoter; Involved in UV light and elicitor responsiveness; Conserved in several elicitor or light-responsive genes; See S000306;

ElRE (Elicitor Responsive Element) core of parsley (P.c.) PR1 genes; consensus sequence of elements W1 and W2 of parsley PR1-1 and PR1-2 promoters; Box W1 and W2 are the binding site of WRKY1 and WRKY2, respectively; ERE; "WA box"; One of the W boxes found in the Parsley (P.c.) WRKY1 gene promoter; Required for elicitor responsiveness; See S000310; "WC box" WB box (S000310) and WC box constitute a palindrome; WRKY1 protein binding site; W-box found in thioredoxin h5 gene in Arabidopsis (Laloi et al.);

Elicitor-responsive element (ElRE); Found in tobacco (N. t.) basic class I chitinase gene (CHN50);

Binding site of trans-acting factor EMBP-1; wheat (T.a.) Em gene; See S000015; Binding site of ABFs; ABFs (ABRE binding factors) were isolated from Arabidopsis by a yeast one-hybrid screening system; Expression ABFs is induced by ABA and various stress treatment; ABFs belongs to a distinct subfamily of bZIP proteins; Involved in ABA-mediated stress-signaling pathway;

"Endosperm motif (EM)" found in the promoter of barley (H.v.) c-hordein gene; Involved in the nitrogen response of c-hordein promoter;

"GCC box" in "ERE (ethylene responsive element)"; Ethylene-responsive region of tobacco (N.t.) chitinase gene contains two copies of the GCC-box; ERF2 and ERF4 enhanced the GCC box-mediated transcription; ERF3 reduced the transcription of the reporter gene in tobacco protoplasts; Binding site of AtEBP; Pti4/5/6 proteins from tomato which belong to the ERF family activate the expression of "GCC box"-containing PR genes; ERF3 was found to interact with NtUBC2, a ubiquitin-conjugating enzyme;

"ERE (ethylene responsive element)" of tomato (L.e.) E4 and carnation GST1 genes; GST1 is related to senescence; Found in the 5'-LTR region of TLC1.1 retrotransposon family in Lycopersicon chilense (Tapia et al.); ERE motifs mediate ethylene-induced activation of the U3 promoter region;

"ESP (endosperm specificity palindrome)" element found in the promoter of oat (A.s.) globulin gene (AsGlo1);

"Evening element" found 46 times in the promoters of 31 cycling genes in Arabidopsis thaliana (Harmer et al. 2000); Required for circadian control of gene expression; "EE (evening element) motif"; Also found in the promoter of the Solanum melongena gene encoding cysteine protease, and identified as cis-element for its circadian regulation (Rawat et al. 2005);
G

Sequence present in 24 genes in the GA-down regulated d1 cluster (106 genes) found in Arabidopsis seed germination; This motif is similar to ABRE (Busk and Pages 1998);

"GA octodinucleotide repeat" found in intron IV of the barley (H.v.) gene Bkn3; Binding site for GAGA-binding factor BBR; See S000405 (GAGA element in the soy bean Gsa1 gene);

"GAGA element" found in the promoter of the heme and chlorophyll synthesis gene Gsa1 in soybean (G.m.); GAGA binding protein (GBP) binds to (GA)n/(CT)n DNA;

"Gibberellin-responsive element (GARE)" found in the promoter region of a cystein proteinase (REP-1) gene in rice; See S000020;

Putative gibberellin responsive element; Consensus sequence of GA inducible alpha-amylase genes from rice, barley and wheat;

"Gibberellin-responsive element (GARE)" found in the promoter region of a cystein proteinase (REP-1) gene in rice; See S000020;

"GARE-4" found in the barley (H.v.) EPB-1 (cysteine proteinase) gene promoter; Located between -142 to -156; Required for GA induction; Putative binding site of transcription factor, GAMyB; See S000298;

GARE (GA-responsive element); Occurrence of GARE in GA-inducible, GA-responsible, and GA-nonresponsive genes found in Arabidopsis seed germination was 20, 18, and 12%, respectively; see S000181;

"GARE (gibberellic acid responsive element)" of barley (H.v.) alpha-amylase gene (Amy 1/6-4); GA3;

"GATA box"; GATA motif in CaMV 35S promoter; Binding with ASF-2; Three GATA box repeats were found in the promoter of Petunia (P.h.) chlorophyll a/b binding protein, Cab22 gene; Required for high level, light regulated, and tissue specific expression; Conserved in the promoter of all LHCII type I Cab genes;

One of 11 G-box sequences in tobacco (N.t.); Required for high-level constitutive expression in seed, leaf, root, axillary bud, almost all parts of flower buds and pollen;

"G box"; Conserved sequence upstream of light-regulated genes; Sequence found in the promoter region of rbcS of tomato (L.e.) and Arabidopsis; Binding with GBF; M=A/C; See S000345;

"G box"; Binding site of parsley (P.c.) cytosolic G-box binding factors (cytosolic GBFs); Cytosolic G-Box binding activity is modulated by light; DNA binding activity of cytosolic GBFs is regulated by cytosolic phosphorylation/dephospholylation activities; Cytosolic GBFs are translocated to the nucleus in a light-regulated manner;

G box-related element found in Amy3D (amylase) promoter of rice (O.s.); Similar to ABRE;

"G-box" found in the spinach(S.O.) RBCS-1 gene promoter; Located between -219 and -212; G-box trimer confers relatively high level expression in roots;

"GCAAC repeat" found in the 22bp recognition site for beta-1 factor in the promoter of beta-zein (prolamin type) gene of maize (Z.m.); GCAAC is the core recognition sequence of the protein encoded by the retroviral oncogene myb (Biedenkapp et al. Nature 335:835-837 (1988));

Binding site of tobacco nuclear factor (GCBP-2) found in the maize (Z.m.) GapC4 (Glyceraldehyde-3-phosphate dehydrogenase 4) gene promoter; Located between -293 and -285; See S000350;

Core of GCC-box found in many pathogen-responsive genes such as PDF1.2, Thi2.1, and PR4; Has been shown to function as ethylene-responsive element; See S000036, S000232, S000332; Appears to play important roles in regulating jasmonate-responsive gene expression; Tomato Pti4 (ERF) regulates defence-related gene expression via GCC box and non-GCC box cis elements (Myb1 (GTTAGTT) and G-box(CACGTG));

"GCN4 motif" found in GluB-1 gene in rice (O.s.); Required for endosperm-specific expression; See S000276; AACA and ACGT motifs was found sufficient to confer a detectable level of endosperm expression; See S000353, S000354; This motif is the recognition site for a basic leucine zipper transcription factor that belongs to the group of maize Opaque-2 (O2)-like proteins; Although all the RISBZ proteins are able to interact with the GCN4 motif, only RISBZ1 is capable of activating the gene expression;

Sequence found in NDE element in Soybean (G.m.) SAUR (Small Auxin-Up RNA) 15A gene promoter; Involved in auxin responsiveness; See S000270, S000359;

"GLM (GCN4-like motif)" found in the promoter of barley (H.v.) B1- and c-hordein gene; Involved in the nitrogen response of c-hordein promoter; R=A/G; S=C/G; See also S000277 (GCN4OSGLUB1); SPA, a seed-specific basic leucine zipper protein from wheat, can activate transcription from the GCN4-like motif (GLM) of -326 LMWG-1D1 promoter (Albani et al., 1997);

"glutelin common motif"; "AACA motif"; Conserved in all member of rice (0.s.) glutelin; -74 to -64;

"Box 1" of rice (O.s.) glutelin Gt2 gene family promoter regions; nuclear factor binding site;

"Box 1" of rice (O.s.) glutelin Gt3 gene family promoter region; See S000128 GLUTEBOX2A;

"Box II" of rice (O.s.) glutelin Gt2 gene family; nuclear factor binding site;

"Box 2" of rice (O.s.) glutelin Gt3 gene family promoter region; See S000128 GLUTEBOX1A;

"Glutelin BP-1"; Binding site in the promoter region of glutelin Gt3 gene family of nuclear factor (PB-1); PB-1 is observed only in nuclear extract of developing seeds;

"Glutelin BP-2"; Binding with nuclear factors from developing seeds;

Core site required for binding of the trans-acting factor in the promoter region of rice (O.s.) glutelin (type 2 glutelin gene family);

Binding site of the soybean homeodomein leucine zipper proteins (GmHdl56, GmHdl57); Found in the phosphate response domain of the soybean VspB promoter; Located between -536 and -527; VspB encodes vacuolar glycoprotein acid phosphatase that serve as vegetative storage protein;

"GRA"; GC-rich rab activator; Found in the promoter of ABA responsive rab17 gene from maize (Z.m.); Important for transcription in leaves but not in embryos; See S000200, S000401 and S000402;

"GRA"; "GC-rich rab activator"; Found in the promoter of ABA responsive rab28 gene from maize (Z.m.); Similar (seven of 12 bases) to the GRA element from the maize rab17 promoter (S000150; GRAZMRAB17); Found at -138 to -130;

"G region" found in tobacco (N.t.) PRB-1b gene promoter; Located at -201 to -178; Binding site of nuclear protein; Required for ethylene induction; Contains an 11bp sequence, TAAGAGCCGCC, which is highly conserved in the promoter of ethylene-induced PR genes; Contains a G box motif; See S000365;

Consensus GT-1 binding site in many light-regulated genes, e.g., RBCS from many species, PHYA from oat and rice, spinach RCA and PETA, and bean CHS15; R=A/G; W=A/T; For a compilation of related GT elements and factors, see Villain et al. (1996); GT-1 can stabilize the TFIIA-TBP-DNA (TATA box) complex; The activation mechanism of GT-1 may be achieved through direct interaction between TFIIA and GT-1; Binding of GT-1-like factors to the PR-1a promoter influences the level of SA-inducible gene expression;

Critical for GT-1 binding to box II of rbcS; See S000051 GT1MOTIF1; For a compilation of related GT elements and factors, see Villain et al. (1996);

"GT-1 motif" found in the promoter of soybean (Glycine max) CaM isoform, SCaM-4; Plays a role in pathogen- and salt-induced SCaM-4 gene expression; See also S000198 (GT-1 consensus);

"GT-1 motif"; "Consensus sequence of rbcS BOX II, III, II', III'"; "GT-1 box"; 5' upstream region (-151) of pea (P.s.) rbcS gene; binding with trans factor GT-1; See S000125 GT1CORE; K=G/T; W=A/T; R=A/G; For a compilation of related GT elements and factors, see Villain et al. (1996);

GT-2 (a rice nuclear protein) binding site in a rice (O.s.) phyA promoter; phyA gene are transcriptionaly repressed in response to light; One of GT elements; For a compilation of related GT elements and factors, see Villain et al. (1996); The HMG-1/Y protein PF1 stimulates binding of the GT-2 to PHYA gene promoter;

"GTGA motif" found in the promoter of the tobacco (N.t.) late pollen gene g10 which shows homology to pectate lyase and is the putative homologue of the tomato gene lat56; Located between -96 and -93; See S000280;
H

"H-box"; Consensus sequence of H-boxes found in bean (Phaseolus vulgaris) chs15 gene promoter; Essential for both light regulation and elicitor induction; Similar sequence was found in tobacco Tnt1 retrotransposon promoter (LTR); Tnt1 is induced by wounding and by abiotic stress; "KAP-2" binds to the H-box and stimulates transcription from a promoter harboring the H-box; "KAP-2" shares sequence similarity to the large subunit of mammalian Ku autoantigen; See S000150, S000402 and S000401;

Binding site of two bean protein factors, KAP-1 and KAP-2; KAP-1 is a 97 kDa polypeptide; KAP-2 comprises two polypeptides of 76 kDa and 56 kDa; Elicitation of bean cell with glutathione causes a rapid increase in specific activities of KAP-1 and KAP2;

HD (homeodomain) protein target site in parsley (P.c.) pathogenesis-related protein 2 (PR2); A potential in vivo target site;

Binding site of the Arabidopsis (A.T.) homeobox gene (ATHB-2) found in its own promoter; Located between -72 and -80; Similar to the HD-ZIP-2 binding consensus sequence; ATHB-2 is regulated by light signals which function as a negative autoregulator of its own gene; M=C/A;

Ath b-9 HD-Zip (HD-Zip-9), a member of a small family of HD-Zip proteins (HD-ZIP III), in Arabidopsis recognize this sequence; See also S000371; S=G/C;

hexamer motif of Arabidopsis thaliana (A.t.) histone H4 promoter;

"Hex motif"; Binding site of Arabidopsis (A.t.) bZIP protein TGA1 and G box binding factor GBF1; TGA1 and members of the GBF family differ in their DNA binding properties; G-Box-like element;

"hexamer motif" found in promoter of wheat (T.a.) histone genes H3 and H4; CaMV35S; NOS; Binding with HBP-1A and HBP-1B; Binding site of wheat (T.a.) nuclear protein HBP-1 (histone DNA binding protein-1); HBP-1 has a leucine zipper motif; "hexamer motif" in type 1 element may play important roles in regulation of replication- dependent but not of replication-independent expression of the wheat histone H3 gene; See S000076, S000267; Rice OBF1-homodimer-binding site (Shimizu et al.);

"HSE (heat shock response element)"; consensus sequence found in the promoter regions of heat shock protein genes; HSF binding site; HsfA3, a new member of the Hsf (heat stress transcription factor) family; was isolated by yeast two-hybrid screening, using HsfA1 as a bait; HsfA3 is a single copy gene with all conserved sequence elements characteristic of a heat stress transcription factor;

"HSE-like motif" in -56 region of acidic PR1 gene of tobacco (N.t.); not found in basic PR1 gene;

"HSE-like sequence" in 5' upstream region of beta-1,3-glucanase gene (GLN2) of tobacco (N.t.);

"HSRE(HSR203 responsive element)" in tobacco (N.t.) responsible for the marked induction of the HSR203J gene during the HR (hypersensitive response); HSR203J is specifically activated during the early steps of incompatible plant/pathogen interactions;

"G box"; Binding site of Arabidopsis bZIP protein HY5; HY5 is constitutively nuclear localized and is involved in light regulation of transcriptional activity of the promoters containing the G-box; See S000041, S000042, S000229; HY5 abundance peaks in early seedling development, consistent with its role in promoting photomorphogenesis; HY5 stability and activity is regulated by phosphorylation in its COP1 binding domain; HY5 regulates stimulus-induced development of root and hypocotyl;
I

"I box"; "I-box"; Conserved sequence upstream of light-regulated genes; Sequence found in the promoter region of rbcS of tomato and Arabidopsis; I box (Giuliano et al. 1988); Binding site of LeMYB1, that is a member of a novel class of myb-like proteins; LeMYBI act as a transcriptional activator;

"I box"; "I-box"; Conserved sequence upstream of light-regulated genes; Conserved sequence upstream of light-regulated genes of both monocots and dicots; See IBOX (S000124);

"I-box core motif" in the CAMs (conserved DNA modular arrays) associated with light-responsive promoter regions; See S000124 (GATAAG), S000199 (GATAA), S000213;

"I-box-like sequence" found in the region (from -254 to -215) of cucumisin (a subtilisin-like serine protease) in the fruit of melon (Cucumis melo L.); I-box-like sequence functions as a negative regulatory element; See S000199 (I-box, GATAA), S000124 (I-box, GATAAG);

IDE1 (iron-deficiency-responsive element 1) found at -153/-136 of barley IDS2 (iron deficiency specific clone 2) gene promoter; See also S000464;

IDE2 (iron-deficiency-responsive element 2) found at -262/-236 of barley IDS2 (iron deficiency specific clone 2) gene promoter; See also S000463;

"IDRS" (Iron-Dependent Regulatory Sequence) found in maize and Arabidopsis ferritin genes (Fer1); IDRS is responsible for transcriptional repression of ZmFer1 gene under low iron supply conditions; S=C/G; K=G/T; IDRS is not involved in the Fe-regulated expression of the AtAPX1 gene (Fourcroy et al., 2004);

"Inr (initiator)" elements found in the tobacco psaDb gene promoter without TATA boxes; Light-responsive transcription of psaDb depends on Inr, but not TATA box;

"3' intron-exon splice junctions"; Plant intron lower sequence; Consensus sequence for plant introns;

"5' exon-intron splice junctions" of plant introns; Plant intron upper sequence; Consensus sequence for plant introns;

OsIRO2-binding core sequence; "G-box plus G"; Transcription factor OsIRO2 is induced exclusively by Fe deficiency;
J

"JASE1"found in promoter of Arabidopsis thaliana 12-oxo-phytodienoic acid-10,11-reductase (OPR1) gene; Located between -179 and -170; Involved in up-regulation by both senescence and JA;

"JASE2"found in promoter of Arabidopsis thaliana 12-oxo-phytodienoic acid-10,11-reductase (OPR1) gene; Located between -112 and -100; Involved in up-regulation by both senescence and JA; JASE2 contains a mixed A/C box-like motif;

"JERE" (jasmonate- and elicitor-responsive element) found in the periwinkle(C.R.) strictosidine synthase(Str) gene promoter; Located between -100 and -58; ORCA1, ORCA2 and ORCA3 bind specifically to the JERE of the Str promoter; Elicitor and MeJA rapidly induce Orca2, but not Orca1 mRNA levels; ORCA3 mRNA accumulation was rapidly induced by the metyljasmonate;
L

"L1 box" found in promoter of Arabidopsis thaliana (A.t.) PROTODERMAL FACTOR1 (PDF1) gene; Located between -134 and -127; Involved in L1 layer-specific expression; L1-specific homeodomain protein ATML can bind to the "L1 box"; Y=C/T; A cotton fiber gene, RD22-like 1 (RDL1), contains a homeodomain binding L1 box and a MYB binding motif (Wang et al., 2004); HDZip IV; See also S000371;

"L1" element, found in PAL1 promoter in carrot (Daucus carota), is a protoplastization (dilution) responsive element; L1 contains Box L-like sequence (ACCTACCC); see also S000492 (BOXL CORE of DC PAL1);

"L4" element, found in PAL1 promoter in carrot (Daucus carota), is a UV-B responsive element; L4 contains Box L-like sequence (TCCAACCA); see also S000492 (BoxL core of DC PAL);

"L box"; Conserved sequence found in rbcS upstream sequences of both tomato (L.e.) and tobacco;

Target sequence of LEAFY in the intron of AGAMOUS gene in Arabidopsis; See Lohmann et al. Cell 105:793-803 (2003);

Core element in LeCp (tomato Cys protease) binding cis-element (from -715 to -675) in LeAcs2 gene;

"legumin box" in legA 5' legumin gene promoter in legumin;

"LRE (light-responsive element) Box II" of pea (P.s.) rbcS-3A gene; GT-1 binding; "GT-motif"; "GT1 motif"; Some similarity to SV40 enhancer core sequence; For a compilation of related GT elements and factors, see Villain et al. (1996); "BoxII" Binding site of transcriptional factor GTI; Located at -152 to -138; Confers light responsiveness;

"LRE (light-responsive element) Box III" of pea (P.s.) rbcS-3A gene; GT-1 binding; For a compilation of related GT elements and factors, see Villain et al. (1996);

"BoxII"; Light responsive element (LRE) found in the parsley (P.c.) CHS-1 (chalcone synthase-1) gene promoter; Required for light responsiveness; nuclear protein binding site; Highly conserved in various light inducible gene promoters; See S000302;

"BoxI"; Light responsive element (LRE) found in the parsley (P.c.) CHS-1 (chalcone synthase-1) gene promoter; Required for light responsiveness; nuclear protein binding site; See S000303; "MRECHS" (MRE=Myb Recognition Element)Recognition site of MYB305 and a novel factor PcMYB1 (Myb1 from P. crispum); PcMYB1 contains only one MYB repeat;

"LRE"; A positive light regulatory element in tobacco (N.p.) CAB (cab-E) gene; Located at -241;

"LS5"; A negative regulatory element found in the Arabidopsis (A.t.) PR-1 gene promoter; Binding site of TGA2; NPR1 increased the binding of TGA2 to the element; NPR1 is essential in activating systemic, inducible plant defense response; See S000322; TGA6 expressed in roots in young seedlings; TGA2.1 is a direct transcriptional activator; TGA2.2 stabilizes TGA2.1 binding; NOTE: The motif sequence previously shown was that of LS7. The correction was made.

"LS7"; A positive salicylic acid-inducible element found in the Arabidopsis (A.t.) PR-1 gene promoter; Binding site of TGA1; NPR1 increased the binding of TGA2 to the element; NPR1 is essential in activating systemic, inducible plant defense responses; See S000323; TGA6 expressed in roots in young seedlings; TGA2.1 is a direct transcriptional activator; TGA2.2 stabilizes TGA2.1 binding; NOTE: The motif sequence previously shown was that of LS5. The correction was made. We are very sorry.

"LTRE-1" (low-temperature-responsive element) in barley (H.v.) blt4.9 gene promoter; A new LTRE; A previously known LTRE is CCGAC;

Putative low temperature responsive element (LTRE); Found in Arabidopsis thaliana (A.t.) low-temperature-induced (lti) genes, lti78 and lti65; Repeated four times in lti78 which is also known as cor78 and rd29A (see S000152)(Baker et al., Plant Mol Biol 24:701(1994)); Found also in barley low temperature responsive genes, blt4.2, blt4.6, blt4.9 (lipid transfer genes); cold inducible; See LTRECORE (S000153); Also present in rab18, kin1, and kin2 (Nordin et al., 1993);

Core of low temperature responsive element (LTRE) of cor15a gene in Arabidopsis (A.t.); A portion of repeat-C (C-repeat), TGGCCGAC, which is repeated twice in cor15a promoter (Baker et al., 1994); ABA responsiveness; Involved in cold induction of BN115 gene from winter Brassica napus; LTRE; See S000157, S000152; Light signaling mediated by phytochrome is necessary for cold- or drought- induced gene expression through the C/DRE in Arabidopsis; See S000152;
M

"A-box" found in SAR(scaffold attachment region; or matrix attachment region, MAR);

"ARS element"; Motif found in SAR (MAR);

"CEN III element"; Motif found in SAR (MAR); centromere element;

"T-Box"; Motif found in SAR (scaffold attachment region; or matrix attachment region, MAR);

MeJa-responsive element (MeJaRE) in tomato (L. e.) lipoxygenase (LOX) gene; Related to tomato lipoxygenase gene expression during development and for MeJa (methyl jasmonate)-responsiveness;

"MNF1" binding site in maize (Z.m.) Ppc1 (phosphoenolpyruvate carboxylase) gene promoter; Involved in light induction;

"MREAtCHS (MRE = Myb Recognition Element)" found in the LRU (light-responsive unit) in Arabidopsis (A.t.) chalcone synthase (CHS) gene promoter; Required for UV-B and UV-A/blue light responsiveness; See S000355;

Cis element in 3' end region of wheat (T.a.) histone H3 mRNA; 3' end formation; Also found in histone genes of other plants, yeast, etc;

mRNA stability determinant found in 5'-UTR of psbD mRNA of Chlamydomonas reinhardtii (C.r.); Required for the stable accumulation; Located within the first 12 nucleotides of the leader region;

mRNA stability determinant found in 5'-UTR of psbD mRNA of Chlamydomonas reinhardtii (C.r.); Required for the stable accumulation; Located near position -30 relative to the AUG initiation codon;

"MSA (M-specific activator)" motif in Catharanthus roseus (C.r.) B-type cyclin (CYM) promoter; Essential for M phase-specific expression; Found at -66 to -58;

MYB recognition site found in the promoters of the dehydration-responsive gene rd22 and many other genes in Arabidopsis; W=A/T;

Tomato Pti4(ERF) regulates defence-related gene expression via GCC box and non-GCC box cis elements (Myb1(GTTAGTT), G box (CACGTG));

Myb26 binding site; Myb26 recognizes the c-Myb and P-box-like binding sites representing cis-elements in the promoter regions of several phenylpropanoid biosynthetic genes; Identical to P-box in maize, and to Myb305 binding site in snapdragon;

Binding site for ATMYB2, an Arabidopsis MYB homolog; ATMYB2 binds oligonucleotides that contained a consensus MYB recognition sequence (TAACTG), such as is in the SV40 enhancer and the maize bronze-1 promoter (Urao et al., Plant Cell 5:1529 (1993)); ATMYB2 is involved in regulation of genes that are responsive to water stress in Arabidopsis; See S000355;

MYB recognition site found in the promoters of the dehydration-responsive gene rd22 and many other genes in Arabidopsis; Y=C/T; K=G/T; See S000177 (MYB2), S000175 (MYBATRD22);

Binding site for MYB (ATMYB2) in dehydration-responsive gene, rd22; MYB binding site in rd22 gene of Arabidopsis thaliana; ABA-induction; Located at ca. -141 of rd22 gene; Also MYC at ca. -200 of rd22 gene; See S000174 (MYCATRD22); See S000355;

Binding site for all animal MYB and at least two plant MYB proteins ATMYB1 and ATMYB2, both isolated from Arabidopsis; ATMYB2 is involved in regulation of genes that are responsive to water stress in Arabidopsis; A petunia MYB protein (MYB.Ph3) is involved in regulation of flavonoid biosynthesis (Solano et al. EMBO J 14:1773 (1995)); See S000355;

"Myb core" in the 18 bp sequence which is able to activate reporter gene without leading to M-phase-specific expression, found in the promoter of Arabidopsis thaliana cyclin B1:1 gene; the 18 bp sequence share homology with a sequence found in the N. sylvestris cyclin B1 promoter (Trehin et al., 1999; see S000283):

Central element of gibberellin (GA) response complex (GARC) in high-pI alpha-amylase gene in barley (H.v.); Similar to c-myb and v-myb consensus binding site; GAmyb binds specifically to the TAACAAA box in vitro; GAmyb is the sole GA-regulated transcriptional factor required for transcriptional activation of the high-pI alpha-amylase; GARC consist of the pyrimidine, TAACAAA and TATCCAC boxes; GARE in RAmy1A gene; GARE and pyrimidine box in RAmy1A are partially involved in sugar repression;

Plant MYB binding site; Consensus sequence related to box P in promoters of phenylpropanoid biosynthetic genes such as PAL, CHS, CHI, DFR, CL, Bz1; Myb305; M=A/C; W=A/T; See S000355; The AmMYB308 and AmMYB330 transcription factors from Antirrhinum majus regulate phenylpropanoid and lignin biosynthesis in transgenic tobacco;

Core of consensus maize P (myb homolog) binding site; W=A/T; 6 bp core; Maize P gene specifies red pigmentation of kernel pericarp, cob, and other floral organs; P binds to A1 gene, but not Bz1 gene; Maize C1 (myb homolog) activates both A1 and Bz1 genes (Grotewold et al. 1994); W=A/T;

Core motif of MybSt1 (a potato MYB homolog) binding site; MybSt1 cDNA clone was isolated by using CaMV 35S promoter domain A as a probe (Baranowskij et al. 1994); The Myb motif of the MybSt1 protein is distinct from the plant Myb DNA binding domain described so far;

MYC recognition sequence (from -466 to -461) necessary for expression of erd1 (early responsive to dehydration) in dehydrated Arabidopsis; NAC protein bound specifically to the CATGTG motif (Tran et al., 2004)); NAC protein bound specifically to the CATGTG motif (Tran et al., 2004);

Binding site for MYC (rd22BP1) in Arabidopsis (A.t.) dehydration-resposive gene, rd22; MYC binding site in rd22 gene of Arabidopsis thaliana; ABA-induction; Located at ca. -200 of rd22 gene; Also MYB at ca. -141 of rd22 gene; See also S000175 (MYBATRD22);

MYC recognition site found in the promoters of the dehydration-responsive gene rd22 and many other genes in Arabidopsis; Binding site of ATMYC2 (previously known as rd22BP1); see S000144 (E-box; CANNTG), S000174 (MYCATRD22); N=A/T/G/C; MYC recognition sequence in CBF3 promoter; Binding site of ICE1 (inducer of CBF expression 1) that regulates the transcription of CBF/DREB1 genes in the cold in Arabidopsis; ICE1 (Chinnusamy et al., 2004);)
N

Sequence found in 5' upstream region (-6, -95, -188) of napin (2S albumin) gene in Brassica napus (B.n.); Interact with a protein present in crude nuclear extracts from developing B. napus seeds;

"NDE" found in Soybean (G.m.) SAUR (Small Auxin-Up RNA) 15A gene promoter; Required for auxin responsiveness; Contains two adjacent sequences, TGTCTC (see S000270) and GGTCCCAT, which have been previously identified as putative auxin-responsive elements; See S000360;

One of two putative nodulin consensus sequences; See also S000462 (NODCON2GM);

One of two putative nodulin consensus sequences; See also S000461 (NODCON1GM);

Nonamer motif of Arabidopsis thaliana (A.t.) histone H4 promoter;

"Nonamer motif" found in promoter of wheat (T.a.) histone genes H3 and H4;

"NRR (negative regulatory region)" in promoter region of Brassica napus (B.n.) extA extensin gene; Removal of this region leads to expression in all tissues within the stem internode, petiole and root;

NtBBF1(Dof protein from tobacco) binding site in Agrobacterium rhizogenes (A.r.) rolB gene; Found in regulatory domain B (-341 to -306); Required for tissue-specific expression and auxin induction;
O

opaque-2 recognition site F1 in Bertholletia excelsa (Brazil nut tree) 2S storage protein gene (be2S1); O2 protein binds to F1, F2 and F3 sequences of be2S1 promoter; F1 is hybrid C/G box;

opaque-2 recognition site F2 in Bertholletia excelsa (Brazil nut tree) 2S storage protein gene (be2S1); O2 protein binds to F1, F2 and F3 sequences of be2S1 promoter; F2 is a new O2-binding sequence related to the O2 target sites of the Coix alpha-coxin, the maize b-32 genes and the AP-1 pseudopalindrome;

opaque-2 recognition site F3 in Bertholletia excelsa (Brazil nut tree) 2S storage protein gene (be2S1); O2 protein binds to F1, F2 and F3 sequences of be2S1 promoter; F3 is hybrid of A/G box;

"OBF5 (ocs element binding factor 5)" binding site found in the Arabidopsis (A.t.) GST6 gene promoter; Similar to Ocs sequence; Located between -426 and -401; See S000305; Overexpression of OBP3 lead to severe growth defect with altered root development and yellowish leaves; All OBP proteins contain transcriptional activation domains in their C-terminal region; Dof protein play important roles in plant growth and development; Binding site of OBF4 and OBF5; See S000305, S000346;

OBP1, 4, and 5 (OBF binding protein) binding site found in the Arabidopsis (A.t.) GST6 gene promoter; Located between -398 and -388; OBP1 is able to stimulate the binding of OBF proteins to the GST6 promoter; See S000304; Overexpression of OBP3 lead to severe growth defect with altered root development and yellowish leaves; All OBP proteins contain transcriptional activation domains in their C-term. region; Dof protein play important roles in plant growth and development; See S000304;

"Type III element"; Oct-containing composite element Type III found in tobacco (N.t.) histone gene promoter; Oct (octomer) motif is paired with CCAAT-box to form Type III element; Required for S-phase specific and meristematic tissue-specific expression;

"Type II element"; Oct-containing composite element Type II found in tobacco (N.t.) histone gene promoter; Oct (octomer) motif is paired with TCA motif to form Type II element; Required for S-phase specific and meristematic tissue-specific expression;

"Type I element"; Oct-containing composite element Type I found in tobacco (N.t.) histone gene promoter; Oct (octomer) motif is paired with Hex motif to form Type I element; Required for S-phase specific and meristematic tissue-specific expression;

"OCS element" in octopine synthase gene (OCS) of Ti-plasmid of Agrobacterium (A.t.); Binding with nuclear protein isolated from tobacco; See OCS motif (S000074); "ocs-like element"; Also found in Arabidopsis glutathione S-transferase gene (GST6); OBF (ocs element binding factor)-binding site; See S000346; Tandem OCSTF binding-sites are essential for the activity of the Ocs-element; The Ocs-element occures rarely in plant gene promoters; See S000357;

"OCS enhancer element" in octopine synthase gene (OCS) of Ti-plasmid of Agrobacterium tumefaciens (A.t.); Binding with nuclear protein isolated from tobacco and maize; See S000346; Tandem OCSTF binding-sites are essential for the activity of the Ocs-element; The Ocs-element occures rarely in plant gene promoters; See S000357; "OCS palindrome" found in tobacco (N.t.) OCS (Octopine synthase gene) promoter; Located at -193 to -178; Binding site of ASF-1; Confers expression of the gene;

"OCS element" found in the soybean (G.m) GH2/4 gene promoter; Required for auxin and salycylic acid responsiveness; Activated by both active and inactive auxin and salicylic acid analogues; See S000074, S000130, S000158, S000304; Tandem OCSTF binding-sites are essential for the activity of the Ocs-element; The Ocs-element occurs rarely in plant gene promoters; See S000357;

Ocs element found in soybean (Glycine max) heat shock gene (Gmhsp26-A) promoter; The element is a functional ocs-element; The element did not affect the promoter's response to heat or wounding;

"Octamer motif" found in promoter of wheat (T.a.) histone genes H3 and H4, and corn histone genes H3 and H4; Arabidopsis histone H4; "histone-specific octamer"; About half of the Oct motifs are present together with another element, HexA, TCA or CCAAT-box, forming OCES (Oct-containing composite elements);

Octamer motif found in histone-gene-specific consensus sequences; 200 base upstream from the initiation codon ATG; Exist in all of seven plant histone genes;

Opaque-2 (O2) target sequence in maize (Z.m.) 22- and 27-kD zein promoters; "ACGT motif"; Related to seed expression; "O2 target sequence"; Gene: maize 22-kD zein; transacting factor: 02;

"opaque-2 binding site" of maize (Z.m.) b-32 (type I ribosome-inactivating protein gene; O2; O2S; O2S and GARE form a gibberellin response complex (GARC)(Rogers and Rogers, 1992);

One of the consensus sequence motifs of organ-specific elements (OSE) characteristic of the promoters activated in infected cells of root nodules; See also S000468;

One of the consensus sequence motifs of organ-specific elements (OSE) characteristic of the promoters activated in infected cells of root nodules; See also S000467;
P

PHR1-binding sequence found in the upstream regions of phosphate starvation responsive genes from several plant species; phr1 (phosphate starvation response 1) gene codes for PHR1 protein related to PSR1 gene in C. reinhardtii;

Box A; Consensus; One of three putative cis-acting elements (boxes P, A, and L) of phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) genes in parsley (P.c.); "None of these elements (boxes P, A, and L) alone, or the promoter region containing all of them together, conferred elicitor or light responsiveness. These elements appear to be necessary but not sufficient for elicitor- or light-mediated PAL gene activation." (Logemann et al., 1995); See also S000136 (Box P), S000138 (Box L);

Box L; Consensus; One of three putative cis-acting elements (boxes P, A, and L) of phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) genes in parsley (P.c.); "None of these elements (boxes P, A, and L) alone, or the promoter region containing all of them together, conferred elicitor or light responsiveness. These elements appear to be necessary but not sufficient for elicitor- or light-mediated PAL gene activation." (Logemann et al., 1995); See also S000136 (Box P), S000137 (Box A);

Box P; Consensus; One of three putative cis-acting elements (boxes P, A, and L) of phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) genes in parsley (P.c.); "None of these elements (boxes P, A, and L) alone, or the promoter region containing all of them together, conferred elicitor or light responsiveness. These elements appear to be necessary but not sufficient for elicitor- or light-mediated PAL gene activation." (Logemann et al., 1995); See also S000137 (Box A), S000138 (Box L);

Palindromic C-box in soybean (G.m.); bZIP factors, STGA1 and STFs (STF1 and STF2) found in soybean apical hypocotyl, bind to this sequence;

"pas"; as-1-related element found in the tobacco (N.t.) parA gene promoter; Involved in Cadmium responsiveness; Not related to copper responsiveness; Located between -68 and -49;

PE1; Positively acting element found at -381 to -348 of oat (A.s.) phyA3 promoter; A general positive element (Terzaghi & Cashmore, 1995);

"pE2F (proximal E2F elemen)" at -143bp of tobacco (N.t.) RNR1a promoter; E2F factors involved in gene induction at the G1/S transition of the cell cycle; Important for regulating specific RNR1a (ribonucleotide reductase large subunit) gene expression in response to UV-C irradiation; See S000367;

PE3; Positively acting element found at -111 to -81 (Bruce et al., 1991) of oat (A.s.) phyA3 promoter;

"PI" found in the Arabidopsis thaliana(A.T.) GAPB gene promoter; Located between -157 and -150; Mutations in the "PI" resulted in reductions of light-activated gene transcription; GAPB encodes the B subunit of chloroplast glyceraldehyde-3-phosphate dehydrogenase(GADPH) of A.T.;

"PII" found in the Arabidopsis thaliana(A.T.) GAPB gene promoter; Located between -69 and -50; Mutations in the "PII" resulted in reductions of light-activated gene transcription; GAPB encodes the B subunit of chloroplast glyceraldehyde-3-phosphate dehydrogenase(GADPH) of A.T.;

"PolyA signal"; poly A signal found in legA gene of pea, rice alpha-amylase; -10 to -30 in the case of animal genes. Near upstream elements (NUE) in Arabidopsis (Loke et al. 2005);

"PolyA signal"; poly A signal found in rice alpha-amylase; -10 to -30 in the case of animal genes. AATAAA; AATAAT; AATTAAA; AATAAG;

"Plant polyA signal"; Consensus sequence for plant polyadenylation signal;

One of two co-dependent regulatory elements responsible for pollen specific activation of tomato (L.e.) lat52 gene; Found at -72 to -68 region; See S000246 (POLLEN2LELAT52); AGAAA and TCCACCATA (S000246) are required for pollen specific expression; Also found in the promoter of tomato endo-beta-mannanase gene (LeMAN5) gene (Filichkin et al. 2004);

One of two co-dependent regulatory elements responsible for pollen specific activation of tomato (L.e.) lat52 gene; Found at -60 to -52 region; See S000245 (POLLEN1LELAT52); AGAAA (S000245) and TCCACCATA are required for pollen specific expression;

"GC element" conserved in the 5' upstream regions of group 2 PR protein genes (beta-1,3-glucanase (GLN2), chitinase (CHN17, CHN50)) of tobacco (N.t.);

"PRE (Pro- or hypoosmolarity-responsive element) found in the promoter region of proline dehydrogenase (ProDH) gene in Arabidopsis; Core of 9-bp sequence ACTCATCCT which is necessary for the efficient expression of ProDH in response to L-Pro and hypoosmolarity (Satoh et al., 2002); ATB2-binding site; Similar to GCN4 motif (ATGA(C/G)TCAT); ATB2 subgroup of bZIP transcription factors function as transcriptional activator for hypoosmolarity-inducible ProDH (Satoh et al., 2004);

Consensus sequence of PRE (plastid response element) in the promoters of HSP70A in Chlamydomonas; Involved in induction of HSP70A gene by both MgProto and light; S=G/C; Y=C/T; R=A/G; H=T/C/A; D=A/T/G;

Motif sequence repeated many times in two positive regulatory elements, PRE1 (-1554 to -1182) and PRE2 (-747 to -516) found far upstream in the tobacco (N.p.) CAB gene (cab-E) promoter; Confer maximum levels of photoregulated expression;

"Prolamin Box"; -330 consensus sequence found in all zein genes; prolamin type consensus sequence found in the 5'upstream regions of seed storage proteins of maize (22 kDa zein); similar sequence found in 19 kDa zein, B-hordein (barley), gamma-gliadin (wheat), high M.W. glutenin (wheat); ESBF-1 enhanced transcriptional activation mediated by SPA (the endosperm-specific wheat bZIP factor);

"Prolamine box" found in the rice (O.s.) GluB-1 gene promoter; Involved in quantitative regulation of the GluB-1 gene; See S000276, S000277, S000278 (for elements in GluB-1); See S000001, S000091, S000265, S000341 (for Prolamin box);

"prox B (proximal portion of B-box) found in napA gene of Brassica napus (B.n.); CA-rich sequence; Found between -130 and -124; Required for seed specific expression and ABA responsiveness; See S000262, S000264; dist B ABRE mediated transactivation by ABI3 adn ABI3-dependent response to ABA; a tetramer of the composite RY/G complex mediated only ABA-independent transactivation by ABI3; B2 domain of ABI3 is necessary for ABA-independent and ABA-dependent activation through the dist B ABRE;

Pollen specific (PS) region in maize (Z.m.) ZM13 gene promoter; Found at -84 to -53;

"Pyrimidine box" found in the barley (H.v.) EPB-1 (cysteine proteinase) gene promoter; Located between -120 to -113; Required for GA induction; See S000297, S000259;

Pyrimidine box found in rice (O.s.) alpha-amylase (RAmy1A) gene; Gibberellin-respons cis-element of GARE and pyrimidine box are partially involved in sugar repression; Found in the promoter of barley alpha-amylase (Amy2/32b) gene which is induced in the aleurone layers in response to GA; BPBF protein binds specifically to this site; See S000265;
Q

"QAR (quantitative activator region)" in promoter region of Brassica napus (B.n.) extA extensin gene;

"Q(quantitative)-element" in maize (Z.m.) ZM13 gene promoter; Found at -107 to -102; Involved in expression enhancing activity; ZM13 is a maize homolog of tomato LAT52 gene; ZM13 is a pollen-specific maize gene;
R

Binding consensus sequence of Arabidopsis (A.t.) transcription factor, RAV1; RAV1 specifically binds to DNA with bipartite sequence motifs of RAV1-A (CAACA) and RAV1-B (CACCTG); RAV1 protein contain AP2-like and B3-like domains; The AP2-like and B3-like domains recognize the CAACA and CACCTG motifs, respectively; The expression level of RAV1 were relatively high in rosette leaves and roots; See S000315(CACCTG);

Binding consensus sequence of an Arabidopsis (A.t.) transcription factor, RAV1; RAV1 specifically binds to DNA with bipartite sequence motifs of RAV1-A (CAACA) and RAV1-B (CACCTG); RAV1 protein contain AP2-like and B3-like domains; The AP2-like and B3-like domains recognize the CAACA and CACCTG motifs, respectively; The expression level of RAV1 were relatively high in rosette leaves and roots; See S000314(CAACA);

"rbcS box II"; 5' upstream region (-151) of pea (P.s.) rbcS gene; Binding with trans factor GT-1; one of GT-1 boxes; For a compilation of related GT elements and factors, see Villain et al. (1996); GT-1 may act as a molecular switch modulated by calcium-dependent phosphorylation and dephosphorylation in response to light signals;

"rbcS box III"; 5' upstream region (-114) of pea (P.s.) rbcS gene; binding with trans factor GT-1; one of GT-1 boxes; For a compilation of related GT elements and factors, see Villain et al. (1996);

"rbcS general consensus sequence"; AATCCAA or AATCCAAC;

"rbcS G-box"; 5'upstream region (-211) of pea rbcS gene; binding with trans factor GBF (CG-1); Light-responsiveness;

"rbe (RSG binding element)" found in the tobacco (N.t.) GA3 gene promoter; Binding site of RSG (Repression of shoot growth); RSG is a bZIP transcriptional activator; RSG regulates the morphology of plants by controlling the endogenous amounts of GAs;

RE1 (putative repressor element) responsible for Pfr-directed repression of oat (A.s.) phyA3 phytochrome gene; Also found in pea AS1 (asparagine synthetase) gene (Ngai, Tsai, Coruzzi: Plant J 12:1021-1234 (1997));

"REalpha" found in Lemna gibba Lhcb21 gene promoter; Located at -134 to -129; Binding site of proteins of whole-cell extracts; The DNA binding activity is high in etiolated plants but much lower in green plants; Required for phytochrome regulation; See S000363;

"REbeta" found in Lemna gibba Lhcb21 gene promoter; Located at -114 to -109; A GATA sequence created at a position six nucleotides upstream could replace the function of REbeta; Required for phytochrome regulation; See S000362;

"region 1" ABRE-like sequence found in rice (O.s.) Osem gene promoter; Important for regulation by ABA; See S000102, S000299; TRAB1, bZIP transcription factor, interacts with VP1 and mediates abscisic acid-induced transcritption;

R-GATA (GATA motif binding factor) binding site; GATA motif is found at -143 to -135 of RTBV promoter; GATA motif is required for phloem-specific gene expression of Rice Tungro Bacilliform Virus (RTBV); See also RNFG1OS (S000188), RNFG2OS (S000189), and ABFOS (S000190);

"Right part of RHEs (Root Hair-specific cis-Elements)" conserved among the Arabidopsis thaliana A7 (AtEXPA7) orthologous (and paralogous) genes from diverse angiosperm species with different hair distribution patterns; K=G/T; W=T/A;

RNFG1 binding site; Box I; RNFG1 is one of two Rice Nuclear Factors required for phloem-specific gene expression of Rice Tungro Bacilliform Virus (RTBV); Box I is found at -3 to +8 of RTBV promoter; See also RNFG2OS (S000189);

RNFG2 binding site; Box II; RNFG2 is one of two Rice Nuclear Factors required for phloem-specific gene expression of Rice Tungro Bacilliform Virus (RTBV); Box II is found at -53 to -39 of RTBV promoter; See also RNFG1OS (S000188); "Box II" is the binding site of bZIP protein RF2a and RF2b; RF2a and RF2b are predominantly expressed in vascular tissue (Dai et al.);

Motif found both in promoters of rolD;

"RSE (root-specific element)" of bean (P.v.) GRP1.8 gene; consensus sequence;See also S000288 and S000289;

"RSE (root-specific element)" found in bean (P.V.) grp1.8 gene promoter; Located at -98 to -73; Required also for vascular-specific expression in stem; See S000288, S000099;

"RSR (root specific region)" in promoter region of Brassica napus (B.n.) extA extensin gene;

"RY repeat motif"; "Sph element"; seed expression; ABA; Gene: maize C1, wheat Em, rice rab16A, maize Rab17; Transacting factor: VP1 (maize C1); See S000105 RYREPEAT2 (CATGCAT); The RY sequence motif does not play a major role in VP1 or ABA regulation of Em gene in protoplast; VP1 gene is specifically required for expression of the maturation program in seed development;

"RY repeat" found in RY/G box (the complex containing the two RY repeats and the G-box) of napA gene in Brassica napus (B.n.); Found between -78 and -50; Required for seed specific expression; See S000262, S000263; dist B ABRE mediated transactivation by ABI3 adn ABI3-dependent response to ABA; a tetramer of the composite RY/G complex mediated only ABA-independent transactivation by ABI3; B2 domain of ABI3 is necessary for ABA-independent and ABA-dependent activation through the dist B ABRE;

"RY repeat motif (CATGCAT)"; Present in the 5' region of the soybean (G.m.) glycinin gene (Gy2);

"RY repeat (CATGCAY)" or legumin box found in seed-storage protein genes in legume such as soybean (G.m.);

"RY repeat motif"; quantitative seed expression; Gene: Vicia faba LeB4; Soybean glycinin (Gy2); other dicot and monocot seed protein genes; "Sph box" found in rice (O.s.) Osem gene promoter; See S000010, S000299, S000300; Binding site of Arabidopsis B3-domain-containing transcription factor FUS3; TRAB1, bZIP transcription factor, interacts with VP1 and mediates abscisic acid-induced transcritption; FUS3 protein physically interact with two RY elements present in the AtGA3ox promoter (Curaba et al., 2004);
S

"S1F box" conserved both in spinach (S.o.) RPS1 and RPL21 genes encoding the plastid ribosomal protein S1 and L21, respectively; Negative element; Might play a role in downregulating RPS1 and RPL21 promoter activity (Lagrange et al., 1993); See S000211 (SITE1SORPS1), S000215 (S1FSORPL21);

"S1F binding site" ("S1 site") in spinach (S.o.) RPL21 gene encoding the plastid ribosomal protein L21; Negative element; Might play a role in downregulating RPL21 promoter activity (Lagrange et al., 1993); See S000211 (SITE1SORPS1), S000166 (S2FSORPL21);

"S2F binding site" ("S2 site") in spinach RPL21 gene encoding the plastid ribosomal protein L21; S2 site (CATACAWW) is conserved in promoter region of many nuclear genes encoding plastid proteins; Leaf-specific, light-independent regulatory element; S2 site is related to but different from the light-responsive GT-1 binding site (Lagrange et al., 1997); For a compilation of related GT elements and factors, see Villain et al. (1996);

Salicylic acid responsive element found in CaMV 35S promoter; Identical to as-1; Binding with ASF-1 (Activation Sequence Factor-1); See AS1 (S000023);

Sclareol box1 (SB1) found at -827 of a plasma membrane ATP binding cassette (ABC) transporter gene (NpABC1) in N. plumbaginifolia; Mutation in SB3 completely abolished sclareolide-mediated expression; See S ;

Sclareol box3 (SB3) found at -216 of a plasma membrane ATP binding cassette (ABC) transporter gene (NpABC1) in N. plumbaginifolia; Mutation in SB3 completely abolished sclareolide-mediated expression; See S ;

"S-box" conserved in several rbcS promoters in Arabidopsis; ABI4 binding site; "Important for the sugar and ABA responsiveness of CMA5"(Acevedo-Hernandez et al., 2005);

"SE1 (Stem element 1)" found in the bean (P.v.) grp1.8 gene promoter; Located between -121 and -94; Enhances the expression strongly but unspecifically; See S000289, S000101 (SE2);

"SE2 (stem element 2)" of bean (P.v.) GRP1.8 gene; part of SE2 element;

Binding site of the potato silencing element binding factor (SEBF) gene found in promoter of pathogenesis-related gene (PR-10a); Located between -45 and -39; Similar to the auxin response element; W=A/T;

"SEF1 (soybean embryo factor 1)" binding motif; sequence found in 5'-upstream region (-640; -765) of soybean beta-conglicinin (7S globulin) gene; W=A/T;

"SEF3 binding site"; Soybean (G.m.) consensus sequence found in the 5' upstream region of beta-conglycinin (7S globulin) gene; AACCCA(-27bp-)AACCCA; SEF=soybean embryo factor; SEF2; SEF3; SEF4;

"SEF4 binding site"; Soybean (G.m.) consensus sequence found in 5'upstream region (-199) of beta-conglycinin (7S globulin) gene (Gmg17.1); "Binding with SEF4 (soybean embryo factor 4)"; R=A/G;

bZIP proteins SGBF-1 and SGBF-2 binding site in soybean (G.m.) GmAux28 gene promoter; see S000042;

Site 1 in the spinach (S.o.) rps1 promoter; S1F binding site; Nuclear genes encoding plastid ribosomal proteins are more highly expressed in leaves than in root; Involved in leaf-specific induction; Seems to be light-independent; Involved in negative regulation; Related to the light-responsive Box II of the pea rbcs-3A promoter; Related to GT elements; For a compilation of related GT elements and factors, see Villain et al. (1996); See S000215 (S1FSORPL21); S1 box=ATGGTA;

Site 3 of spinach (S.o.) rps1 promoter; S1F binding site; For a compilation of related GT elements and factors, see Villain et al. (1996);

"Site IIa" of rice (O.s.) PCNA (proliferating cell nuclear antigen) gene; Found at -197 to -188; Binding site for two nuclear proteins, PCF1 and PCF2 (Kosugi and Ohashi, 1997); Suggested to be involved in meristematic tissue-specific expression; Resemble the conserved motif (T/GGTCCCAT) found in promoter regions of auxin-regulated genes; See S000026 (AUXREPSIAA4);

"Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);)

"Site IIb" of rice PCNA (proliferating cell nuclear antigen) gene; Found at -178 to -169; Binding site for two nuclear proteins, PCF1 and PCF2 (Kosugi and Ohashi, 1997); Suggested to be involved in meristematic tissue-specific expression; Resemble the conserved motif (T/GGTCCCAT) found in promoter regions of auxin-regulated genes; See S000026 (AUXREPSIAA4);

"Site I" of rice (O.s.) PCNA (proliferating cell nuclear antigen) gene; Found at -201 to -194; Resemble G-box; May contribute in part to transcriptional activation;

one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; SORLIP 1 is most over-represented, and most statistically singnificant; See also S000483, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs); Over-represented in light-induced cotyledon and root common genes and root-specific genes (Jiao et al. 2005; see S000486);

one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);

one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000483, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);

one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000483, S000484, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);

one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000483, S000484, S000485 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs); Over-represented in both light-induced cotyledon-specific and root-specific genes (Jiao et al. 2005; see S000482);

one of "Sequences Over-Represented in Light-Repressed Promoters (SORLREPs) in Arabidopsis; Computationally identified phyA-repressed motifs; See also S000488, S000489, S000490 (all SORLREPs); and also S000482, S000483, S000484, S000485, S000486 (all SORLIPs);

one of "Sequences Over-Represented in Light-Repressed Promoters (SORLREPs) in Arabidopsis; Computationally identified phyA-repressed motifs; See also S000487, S000489, S000490 (all SORLREPs); and also S000482, S000483, S000484, S000485, S000486 (all SORLIPs);

one of "Sequences Over-Represented in Light-Repressed Promoters (SORLREPs) in Arabidopsis; Computationally identified phyA-repressed motifs; Common in circadian-regulated promoters; See also S000487, S000488, S000490 (all SORLREPs); and also S000482, S000483, S000484, S000485, S000486 (all SORLIPs);

one of "Sequences Over-Represented in Light-Repressed Promoters (SORLREPs) in Arabidopsis; Computationally identified phyA-repressed motifs; See also S000487, S000488, S000489 (all SORLREPs); and also S000482, S000483, S000484, S000485, S000486 (all SORLIPs);

One of SPBF binding site (SP8a); Found at -155 of gSPO-A1 (sporamin) gene, and also at -880 of gB-Amy (beta-amylase) gene in sweet potato (I.b.); SP8BF recognizes both SP8a and SP8b sequences; See also SP8BFIBSP8BIB (S000184); SP8BF activity is also found in tobacco; "SP8a" found in the 5' upstream region of three differnt genes coding for sporamin and beta-amylase; Binding site of SPF1; SPF1 also binds to the SP8b; See S000184;

One of SPBF binding site (SP8b); Found at -330, -220, and -200 of gSPO-B1 (sporamin) gene, and also at -80 of gB-Amy (beta-amylase) gene; SP8BF recognizes both SP8a and SP8b sequences; See also SP8BFIBSP8AIB (S000183); SP8BF activity is also found in tobacco; "SP8b" found in the 5' upstream region of three differnt genes coding for sporamin and beta-amylase; Binding site of SPF1; SPF1 also binds to the SP8b; See S000184;

Core of Sph element; Core motif of Sph element in maize (Z.m.) C1 gene to which maize VP1 (viviparous 1) protein binds; VP1-responsive element; see RYREPEAT4 (S000010); VP1 gene is specifically required for expression of the maturation program in seed development; VP1 is a novel transcription factor possibly involved in potentiation of a seed-specific hormone response;

"Sph element" found in the maize (Z.m.) C1 gene promoter; Located between -142 and -132; Essential for VP1 activation; See S000154, S000294; VP1 gene is specifically required for expression of the maturation program in seed development; VP1 is a novel transcription factor possibly involved in potentiation of a seed-specific hormone response;

"sugar-repressive element (SRE)" found in 272 of the 1592 down-regulated genes after main stem decapitation in Arabidopsis; See also S000471, S000472;

Stress responsive element (SRE) in tobacco (N.t.) retrotransposon Tto1; A 13 bp cis-regulatory element in the LTR promoter of the tobacco retrotransposon Tto1; Involved in responsiveness to tissue culture, wounding, methyl jasmonate and fungal elicitors; Contains a conserved motif, Box L;

Sucrose Responsive Element (SURE); A motif conserved among genes regulated by sucrose; See also SURE2STPAT21 (S000185); Found between -184 and -156 bp in the patatin (a major tuber protein) gene promoter of potato (S.t.);

Sucrose Responsive Element 2 (SURE2); A motif conserved among genes regulated by sucrose; See also SURE1ST (S000186); Found between -184 and -156 bp in the patatin (a major tuber protein) gene promoter of potato (S.t.);

"SURE-a"; Sugar-responsive element found in barley (H. vulgare) iso1 (encoding isoamylase1) promoter at -597 to -573; Highly similar to SURE of potato class-1 putative promoter; SUSIBA2 (WRKY transcription factor) binding site;

Core of sulfur-responsive element (SURE) found in the promoter of SULTR1;1 high-affinity sulfate transporter gene in Arabidopsis; SURE contains auxin response factor (ARF) binding sequence (GAGACA)(see S000270 ARF:TGTCTC; its complementary seq is GAGACA), and this core sequence is a part of it; this core seq is involved in -S response; Beware of other SURE (sucrose responsive element) !!;

"SV40 core enhancer"; Similar sequences found in rbcS genes; W=A/T;
T

"T/G-box" found in tomato proteinase inhibitor II (pin2) and leucine aminopeptidase (LAP) genes; Involved in jasmonate (JA) induction of these genes; bHLH-Leu zipper JAMYC2 and JAMYC10 proteins specifically recognaize this motif (Boter et al., 2004);

TAAAG motif found in promoter of Solanum tuberosum (S.t.) KST1 gene; Target site for trans-acting StDof1 protein controlling guard cell-specific gene expression; KST1 gene encodes a K+ influx channel of guard cells; See S000265;

TacBBF (TAC box binding factor) binding site in tobacco (N.t.) 5-epi-aristolochene synthase (EAS4) gene; Required for elicitor-inducibility; EAS is involved in sesquiterpene phytoalexin biosynthesis; Found between -245 and -232; Appears to function as a silencer or repressor of EAS gene expression;

"TATA box"; TATA box found in the 5'upstream region of rice alpha-amylase; TATA box found in beta-phaseolin promoter (Grace et al.); sequence and spacing of TATA box elements are critical for accurate initiation (Grace et al.);

"TATA box"; TATA box found in the 5'upstream region of pea legA gene; sporamin A of sweet potato; TATA box found in beta-phaseolin promoter (Grace et al.); sequence and spacing of TATA box elements are critical for accurate initiation (Grace et al.);

"TATA box"; TATA box found in the 5'upstream region of sweet potato sporamin A gene;

"TATA box"; TATA box found in the 5'upstream region of pea (Pisum sativum) glutamine synthetase gene; a functional TATA element by in vivo analysis;

Binding site for OsTBP2, found in the promoter of rice pal gene encoding phenylalanine ammonia-lyase; OsTFIIB stimulated the DNA binding and bending activities of OsTBP2 and synergistically enhanced OsTBP2-mediated transcription from the pal promoter;

"TATA-like motif"; A TATA-like sequence found in Phaseolus vulgaris tRNALeu gene promoter; Frequently observed upstream of plant tRNA genes; Found in maize glycolytic glyceraldehyde-3-phospate dehydrogenase 4 (GapC4) gene promoter; Binding site of TATA binding protein (TBP);

"TATCCAC box" is a part of the conserved cis-acting response complex (GARC) that most often contain three sequence motifs, the TAACAAA box (see S000181), or GA-responsive element (GARE); the pyrimidine box, CCTTTT (see S000259); and the TATCCAC box, which are necessary for a full GA response;

"TATCCA" element found in alpha-amylase promoters of rice (O.s.) at positions ca.90 to 150bp upstream of the transcription start sites; Binding sites of OsMYBS1, OsMYBS2 and OsMYBS3 which mediate sugar and hormone regulation of alpha-amylase gene expression; See also S000021 (AMYBOX2); S000256 (TATCCAY motif);

"TATCCAY motif" found in rice (O.s.) RAmy3D alpha-amylase gene promoter; Y=T/C; a GATA motif as its antisense sequence; TATCCAY motif and G motif (see S000130) are responsible for sugar repression (Toyofuku et al. 1998);

"Tbox" found in the Arabidopsis thaliana (A.T.) GAPB gene promoter; Located between -94 and -89 (T1) and also between -84 and -79 (T2); Mutations in the "Tbox" resulted in reductions of light-activated gene transcription; GAPB encodes the B subunit of chloroplast glyceraldehyde-3-phosphate dehydrogenase(GADPH) of A.T.;

TCA-1 (tobacco nuclear protein 1) binding site; Related to salicylic acid-inducible expression of many genes; Found in barley beta-1,3-glucanase and over 30 different plant genes which are known to be induced by one or more forms of stress; A similar sequence (TCATTTCTT) was found in tobacco Tnt1 retrotransposon promoter (Mhiri et al., 1997);

TDBA12 binding site found in tobacco (N.t.) basic class I chitinase gene (CHN50); Elicitor response element; TDBA12 belongs to WRKY proteins that appear to be unique to plants; TDBA12 is activated by TMV infection in resistant tobacco plant and by plant defense signal molecule SA;

"te2f-2" found in the promoter of tobacco PCNA gene; Located between -84 and -77; Binding site of OsE2F1 and OsE2F2; Involved in transcriptional activation in actively dividing cells and tissue;

"tef1 box" found in the Arabidopsis (A.t.) EF-1 alpha A1 gene promoter; Conserved in the A.t. EF-1 alpha gene promoters; Involved in the activation of EF-1 alpha gene; Involved in the transcriptional activation of plant genes that are overexpressed in cycling cells; Conserved in the promoters of genes for products related to the translational apparatus;

"tef-box" found in the Arabidopsis (A.t.) eEF1AA1 gene promoter; An activating sequence associated with telo-box (S000308); Required for the gene expression in root primordia; Acts co-operatively with telo-box; See S000308;

"telo-box" (telomere motif) found in the Arabidopsis (A.t.) eEF1AA1 gene promoter; Conserved in all known plant eEF1A gene promoters; Found in the 5' region of numerous genes encoding components of the translational apparatus; Required for the activation of expression in root primordia; Acts co-operatively with tef-box; Binding site of AtPur alpha-1; See S000309, S000474;

TGA1a binding site in tobacco (N.t.) PR1a gene; as-1-like sequence; Contains two TGACG elements reminiscent of activation sequence-1 (as-1); See other as-1-like sequences; TGA1a is preferentially expressed in root tip meristems; TGA1a may contribute to the expression of GST isoenzymes, especially in root tip meristems;

"TGACGT motif" found in the Vigna mungo (V.m.) alpha-Amylase (Amy) gene promoter; Located between -128 and -123; Required for high level expression of alpha-Amylase in the cotyledons of the germinated seeds; See S000234;

"TGTCACA motif" found in the region (from -254 to -215) of cucumisin (a subtilisin-like serine protease) in the fruit of melon (Cucumis melo L.); A novel enhancer element necessary for fruit-specific expression of the cucumisin gene;

"TL1", a consensus sequence overrepresented in the promoter regions of all 13 NPR1-responsive ER-resident genes surveyed; NPR1 is "Nonexpressor of pathogenesis-related genes 1", also known as NIM1;

Topoisomerase cleavage site consensus sequence; Motif found in SAR (scaffold attachment region; or matrix attachment region, MAR); W=T/A,

Context sequence of translational initiation codon in dicots; M=A/C;

Context sequence of translational initiation codon in monocots; R=A/G; M=A/C;
U

"Up1" motif found in 162 of the 1184 up-regulated genes after main stem decapitation in Arabidopsis; W=A/T; See also S000470, S000472;

"Up2" motif found in 193 of the 1184 up-regulated genes after main stem decapitation in Arabidopsis; W=A/T; See also S000470, S000471;

"ERSEII-like sequence" found in the plant UPRE (unfolded protein response element) in A.t.; See S000429; Either of ERSEII or XBP1 binding sites is essential and sufficient for the UPR; See S000425, S000426;

"XBP1 binding site-like sequence" found in the plant UPRE (unfolded protein response element) in A.t.; See S000428; Either of ERSEII or XBP1 binding sites is essential and sufficient for the UPR; See S000425 (CCACGTCA), S000426;

"Motif I" in the conserved UPR (unfolded protein response) cis-acting element in Arabidopsis genes coding for SAR1B, HSP-90, SBR-like, Ca-ATPase 4, CNX1, PDI, etc.; See S000429 (CCACGTCATC); See also S000426, S000428, S000429;

"Motif II" in the conserved UPR (unfolded protein response) cis-acting element in Arabidopsis genes coding for SAR1B, HSP-90, SBR-like, Ca-ATPase 4, CNX1, PDI, etc.; See S000425, S000428, S000429;
V

"VOZ-binding sequence" found in the promoter of A. thaliana V-PPase (vacuolar H+-pyrophosphatase) gene; Involved in its expression during pollen development; one-zinc finger;(Mitsuda et al., 2004);

VSF-1 binding site in French bean (P.v.) grp1.8 gene promoter; VSF-1 is a tomato bZIP transcription factor; VSF-1 binding site is found in 28 bp vs-1 element; This sequence controls vascular gene expression in transgenic tobacco; "VS-1" found in bean grp1.8 gene promoter; Located between -203 and -176; Partially overlaps with NRE; Confers xylem-specific expression;
W

"WAR (wounding activating region)" in Brassica napus (B.n.) extA extensin gene;

"WB box"; WRKY proteins bind specifically to the DNA sequence motif (T)(T)TGAC(C/T), which is known as the W box; Found in amylase gene in sweet potato, alpha-Amy2 genes in wheat, barley, and wild oat, PR1 gene in parsley, and a transcription factor gene in Arabidopsis; The motif was initially registered in PLACEdb as TTGACT, and was corrected to TTGACY on 22 June, 2006; Y=C/T;

"W-box" found in promoter of Arabidopsis thaliana (A.t.) NPR1 gene; Located between +70 and +79 in tandem; They were recognized specifically by salicylic acid (SA)-induced WRKY DNA binding proteins; See S000142 (SQ=TTGACC); See S000310 (SQ=TTTGACY); A cluster of WRKY binding sites act as negative regulatory elements for the inducible expression of AtWRKY18 (Chena and Chen, 2002);

W-box found in the promoter region of the CAD1-A (cotton (+) delta-cadinene synthase-A) gene (located in the region -340 to -327) of cotton (G.a); Binding site of GaWRKY1; GaWRKY1 regulates sesquiterpene biosynthesis in cotton; See S000390 (TTGAC), S000142 (TTGACC);

SUSIBA2 bind to W-box element in barley iso1 (encoding isoamylase1) promoter;

"W box" identified in the region between -125 and -69 of a tobacco class I basic chitinase gene CHN48; NtWRKY1, NtWRKY2 and NtWRKY4 bound to W box; NtWRKYs possibly involved in elicitor-respsonsive transcription of defense genes in tobacco; Y=C/T; see also S000442 (TGACT) and S000447 (TGAC);

"W box" found in the promoter region of a transcriptional repressor ERF3 gene in tobacco; May be involved in activation of ERF3 gene by wounding;(Nishiuchi et al., 2004) Y=C/T; See S000142, S000390, S000442, S000447;

Binding site of wound-inducible nuclear protein from wounded tomato leaves; Found in the promoter region of a protease inhibitor IIK gene from potato (S.t.);

"Wound-responsive element (WRE)" found in the promoter region of cucumber (C.s.) ascorbate oxidase gene, CsAAO1; Binding site of proteins in tobacco nuclear extracts; W=A/T; S=C/G;

"A core of TGAC-containing W-box" of, e.g., Amy32b promoter; Binding site of rice WRKY71, a transcriptional repressor of the gibberellin signaling pathway; Parsley WRKY proteins bind specifically to TGAC-containing W box elements within the Pathogenesis-Related Class10 (PR-10) genes (Eulgem et al., 1999); See S000390 (TTGAC), S000442 (TGACT);

Target sequence of WUS in the intron of AGAMOUS gene in Arabidopsis; See Lohmann et al. Cell 105:793-803 (2003);
X

cis-element identified among the promoters of the "core xylem gene set";
Y

"Y region" found in tobacco (N.t.) PRB-1b gene promoter; Located at -179 to -154; Binding site of nuclear protein; Required for ethylene induction; See S000364;
Z

"Z-DNA-forming sequence" found in the Arabidopsis (A.t.) chlorophyll a/b binding protein gene (cab1) promoter; Involved in light-dependent developmental expression of the gene; "Z-box"; Activation of Z-box containing promoters is regulated by downstream regulatory components, COP1 and HY5; phyB and CRY1 photoreceptors act redundantly to induce Z-box containing promoters in white light;

"-10 promoter element" found in the barley (H.v.) chloroplast psbD gene promoter; Involved in the expression of the plastid gene psbD which encodes a photosystem II reaction center chlorophyll-binding protein that is activated by blue, white or UV-A light;

"-141 sequence"; Binding site of tobacco (N.t.) TGA1a-related protein,PG13, found in the G13 gene promoter; PG13 (Protein encoded by G13) shows high homology to TGA1a; ASF-1, PG13, and TGA1a bind to the same target sequence in the 5' upstream region of G13 suggesting that autoregulation of transcription may involved in the control of G13 expression; TGA1a is preferentially expressed in root tip meristems; TGA1a may contribute to the expression of GST isoenzymes, especially in root tip meristems;

Located between -284 and -255 region of maize (Z.m.) Sbe1 gene promoter; Critical positive cis element; Important for the high-level, sugar-responsive expression of the Sbe1 gene in maize endosperm cells; Recognized by nuclear protein; See S000284;

"TGTAAAG core motif" in "-300 elements" of alpha-zein genes of maize; "-300 element core"; "prolamin box" by Vicente-Carbajosa et al. (Proc Natl Acad Sci USA 94:7685 (1997)); P-box; Binds with P-box binding factor (PBF); Binds with BPBF (Barley PBF); PBF is a DNA-binding protein of the DOF class of transcription factors;

Present upstream of the promoter from the B-hordein gene of barley and the alpha-gliadin, gamma-gliadin, and low molecular weight glutenin genes of wheat; See S000001 -300CORE; See S000002 -300MOTIF;

Motif in -300 elements of alpha-zein genes of maize (Z.m.); homologous to the sequence to which transacting factors of AP-1, fos, jun or yeast hisS bind;

Located between -314 and -295 region of maize (Z.m.) Sbe1 gene promoter; Critical positive cis element; Important for the high-level, sugar-responsive expression of the Sbe1 gene in maize endosperm cells; Recognized by nuclear protein; See S000285;

"14 bp region" (from -599 to -566) necessary for expression of erd1 (early responsive to dehydration) in dehydrated Arabidopsis;

"20nt (20 nucleotide sequence)" found in the promoter on tobacco (N.t.) nopalin synthase (nos) gene promoter; Containing two hexamer motifs (TGAGCT) and a spacer region; The spacer region between two hexamer motifs is essential; Important for the gene expression; Essential for response to wounding, auxin, MJ, and SA; Very similar to ASF-1 binding site (See S000073); See S000053(ACGTCA);

"23 bp UAS (Upstream activating sequence)" found in the promoter of Nicotiana sylvestris (N.s.) CycB1 gene; Located between -386 and -409; Contains a 5 bp element identical to the MYB binding core (ACGT); Required for M-phase-specific expression; Binds protein complexes in a cell cycle-regulated manner;

23 bp sequence found in the maize (Z.m.) gamma-class 27kDa zein gene promoter; Contains -300 element (also called the endosperm box or prolamin box); Binding site of nuclear protein; Confers a high level of transcriptional activity in an orientation-dependent manner; -300 element is involved in the common regulatory mechanisms mediating the coordinated expression of the zein genes;

The consensus sequence of 27 bp imperfect repeats found in the untrascribed spacer close to the 3'end of the pea (P.s.) 25S gene; Involved in the rDNA replication fork barrier; Nuclear protein(s) specifically bound to this repeat; W=T/A; M=A/C;

Conserved in many storage-protein gene promoters; May be important for high activity of the napA promoter;

"3AF1 binding site"; tetramer in the light-responsive promoter of pea (P.s.) rbcS-3A gene; "Box VI"; One of "AT-rich sequences" which have been found in numerous light-regulated promoters (Terzaghi & Cashmore, 1995); 3AF1 site includes a GATA motif;

"52/56 box"; A sequence motif shared between the tomato (L.e.) LAT(Late Anther Tomato)52 and LAT56 promoters; Encompassing "PB core motif" (TGTGGTT), and is closely related to the box II sequence motif in the pea rbcS-3A gene promoter; Involved in modulating the activity of the LAT gene promoters in pollen; Dispensable for the developmental regulation of the LAT52 gene in pollen; 52/56 box may be a target for the binding of a member of the GT-1 transcription factor family;

"56/59 box"; A sequence motif shared between the tomato (L.e.) LAT(Late Anther Tomato)56 and LAT59 promoters; Found in -103 to -94 in LAT56 and in -114 to -105 in LAT59; Involved in modulating the activity of the LAT gene promoters in pollen; W=A/T;

×1st. step: Input keywords

e.g., " Bradi1g43* 3000 "

×2nd. step: Choose one or multiple cis -motifs
A

Consensus motif: CACGTGGC
Author: Guiltinan MJ, Marcotte WR Jr, Quatrano RS.
Title: A plant leucine zipper protein that recognizes an abscisic acid response element
Reference: Science 250:267-270 (1990)

Consensus motif: (C/T)ACGTGGC
Author: Choi H, Hong J, Ha J, Kang J, Kim SY
Title: ABFs, a family of ABA-responsive element binding factors
Reference: J Biol Chem. 275: 1723-1730 (2000)

Consensus motif: (C/G/T)ACGTG(G/T)(A/C)
Author: Shinozaki K., Yamaguchi-Shinozaki K.
Title: Molecular responses to dehydration and low temperature
Reference: Curr. Opin. Plant Biol. (2000) 3:217-223

Consensus motif: GACACGTAGA
Author: Hartmann U, Valentine WJ, Christie JM, Hays J, Jenkins GI, Weisshaar B
Title: Identification of UV/blue light-response elements in the Arabidopsis thaliana chalcone synthase promoter using a homologous protoplast transient expression system
Reference: Plant Mol Biol (1998) 36: 741-754

Consensus motif: CCATTTTTAGT
Author: Tilly J. J., Allen D. W., Jack T.
Title: The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects
Reference: Development 125:1647-1657 (1998)

Consensus motif: AAAACAGAATAGGAAA
Author: Ito et al.
Title: The homeotic protein AGAMOUS controls microsporogenesis by regulation of SPOROCYTELESS
Reference: Nature, 430: 356-360 (2004)

Consensus motif: CCATTTTTGG
Author: Riechmann J. L., Krizek B. A., Meyerowitz E. M.
Title: Dimerization specificity of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS
Reference: Proc. Natl. Acad. Sci. USA 93:4793-4798 (1996)

Consensus motif: TT(A/G/T)CC(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)GG(A/C/T)
Author: Shiraishi H, Okada K, Shimura Y
Title: Nucleotide sequences recognized by the AGAMOUS MADS domain of Arabidopsis thaliana in vitro
Reference: Plant J 4: 385-398 (1993)

Consensus motif: NTT(A/G/T)CC(A/T)(A/T)(A/T)(A/T)NNGG(A/T)AAN
Author: Huang H, Tudor M, Su T, Zhang Y, Hu Y, Ma H
Title: DNA binding properties of two Arabidopsis MADS domain proteins: binding consensus and dimer formation
Reference: Plant Cell 8: 81-94 (1996)

Consensus motif: CCAATTTAATGG
Author: Wang H, Caruso LV, Downie B, Perry SE
Title: The Embryo MADS Domain Protein AGAMOUS-LIKE15 Directly Regulates Expression of a Gene Encoding an Enzyme Involved in Gibberellin Metabolism
Reference: Plant Cell 16: 1206-1219. (2004)

Consensus motif: NN(A/T)NCCA(A/T)(A/T)(A/T)(A/T)T(A/G)G(A/T)(A/T)AN
Author: Huang H, Tudor M, Su T, Zhang Y, Hu Y, Ma H
Title: DNA binding properties of two Arabidopsis MADS domain proteins: binding consensus and dimer formation
Reference: Plant Cell 8: 81-94 (1996)

Consensus motif: TT(A/T)C(C/T)A(A/T)(A/T)(A/T)(A/T)T(A/G)G(A/T)AA
Author: Huang H, Tudor M, Weiss CA, Hu Y, Ma H
Title: The Arabidopsis MADS-box gene AGL3 is widely expressed and encodes a sequence-specific DNA-binding protein
Reference: Plant Mol Biol 28:549-567 (1995)

Consensus motif: CCATTTTTAG
Author: Tilly J. J., Allen D. W., Jack T.
Title: The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects
Reference: Development 125:1647-1657 (1998)

Consensus motif: CCATTTTTGG
Author: Riechmann J. L., Krizek B. A., Meyerowitz E. M.
Title: Dimerization specificity of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS
Reference: Proc. Natl. Acad. Sci. USA 93:4793-4798 (1996).

Consensus motif: TGTCTC
Author: Ulmasov T, Hagen G, Guilfoyle TJ
Title: Dimerization and DNA binding of auxin response factors
Reference: Plant J 19:309-319 (1999)

Consensus motif: TGTCTC
Author: Ulmasov T, Hagen G, Guilfoyle TJ
Title: Dimerization and DNA binding of auxin response factors
Reference: Plant J 19:309-319 (1999)

Consensus motif: ACTCAT
Author: Satoh et al
Title: A Novel Subgroup of bZIP Proteins Functions as Transctiptional Activators in Hypsosmolarity-Responsive Expression of the ProDH gene in Arabidopsis
Reference: Plant Cell Physiol. 45(3):300-317. (2004)

Consensus motif: CAAT(A/T)ATTG
Author: Sessa G, Morelli G, Ruberti I
Title: The Athb-1 and -2 HD-Zip domains homodimerize forming complexes of different DNA binding specificities
Reference: EMBO J 12:3507-3517 (1993)

Consensus motif: CAAT(C/G)ATTG
Author: Sessa G, Morelli G, Ruberti I
Title: The Athb-1 and -2 HD-Zip domains homodimerize forming complexes of different DNA binding specificities
Reference: EMBO J 12:3507-3517 (1993)

Consensus motif: CAATNATTG
Author: Johannesson H, Wang Y, Engstrom P.
Title: DNA-binding and dimerization preferences of Arabidopsis homeodomain-leucine zipper transcription factors in vitro
Reference: Plant Mol Biol 45: 63-73 (2001)

Consensus motif: CAATTATTA
Author: Himmelbach A, Hoffmann T, Leube M, Hohener B, Grill E.
Title: Homeodomain protein ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis
Reference: EMBO J. 21:3029-3038 (2002)

Consensus motif: CTAACCA
Author: Shinozaki K
Title: Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression.
Reference: Plant Cell 9:1859-1868 (1997)

Consensus motif: CACATG
Author: Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K
Title: Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression.
Reference: Plant Cell 9:1859-1868 (1997)
B

Consensus motif: AAATTAAA
Author: Bao X, Franks RG, Levin JG, Liu Z
Title: Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems
Reference: Plant Cell 16: 1478-1489 (2004)

Consensus motif: AAATTAGT
Author: Bao X, Franks RG, Levin JG, Liu Z
Title: Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems
Reference: Plant Cell 16: 1478-1489 (2004)

Consensus motif: ACTAATTT
Author: Bao X, Franks RG, Levin JG, Liu Z
Title: Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems
Reference: Plant Cell 16: 1478-1489 (2004)

Consensus motif: GGTTAA
Author: Le Gourrierec J, Li YF, Zhou DX.
Title: Transcriptional activation by Arabidopsis GT-1 may be through interaction with TFIIA-TBP-TATA complex
Reference: Plant J. 1999 Jun;18(6):663-8.
C

Consensus motif: CC(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)GG
Author: Hepworth SR, Valverde F, Ravenscroft D, Mouradov A, Coupland G.
Title: Antagonistic regulation of flowering-time gene SOC1 by CONSTANS and FLC via separate promoter motifs
Reference: EMBO J. 21: 4327-4337 (2002)

Consensus motif: GTTTACATAAATGGAAAA
Author: Tilly JJ, Allen DW, Jack T.
Title: The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects.
Reference: Development. 1998 May;125(9):1647-57

Consensus motif: CTTACCTTTCATGGATTA
Author: Tilly JJ, Allen DW, Jack T.
Title: The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects.
Reference: Development. 1998 May;125(9):1647-57

Consensus motif: CTTTCCATTTTTAGTAAC
Author: Tilly JJ, Allen DW, Jack T.
Title: The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects.
Reference: Development. 1998 May;125(9):1647-57

Consensus motif: TGGCCGAC
Author: Hao D, Yamasaki K, Sarai A, Ohme-Takagi M.
Title: Determinants in the sequence specific binding of two plant transcription factors, CBF1 and NtERF2, to the DRE and GCC motifs.
Reference: Biochemistry. 2002 Apr 2;41(13):4202-8

Consensus motif: CCACGTGG
Author: Pla M, Vilardell J, Guiltinan MJ, Marcotte WR, Niogret MF, Quatrano RS, Pages M
Title: The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.
Reference: Plant Mol Biol 21:259-266 (1993)

Consensus motif: AA(A/C)AATCT
Author: Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM.
Title: A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene
Reference: Plant cell 9:491-507 (1997)

Consensus motif: AAACAATCTA
Author: Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM
Title: A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene.
Reference: Plant cell 9:491-507 (1997)

Consensus motif: AAAAAAAATCTATGA
Author: Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM
Title: A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene.
Reference: Plant cell 9:491-507 (1997)
D

Consensus motif: ACACNNG
Author: Kim SY, Chung HJ, Thomas TL.
Title: Isolation of a novel class of bZIP transcription factors that interact with ABA-responsive and embryo-specification elements in the Dc3 promoter using a modified yeast one-hybrid system
Reference: Plant J 11: 1237-1251 (1997)

Consensus motif: TACCGACAT
Author: Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K
Title: Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor
Reference: Nat Biotechnol 17: 287-291 (1999)

Consensus motif: (A/G/T)(A/G)CCGACN(A/T)
Author: Chen W., Provart N. et al.
Title: The Expression Profile Matrix of Arabidopsis Transcription Factor Genes Suggests Their Putative Functions in Response to Environmental Stresses
Reference: Plant Cell (2002) 14:559-574

Consensus motif: TACCGACAT
Author: Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K
Title: Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor
Reference: Nat Biotechnol 17: 287-291 (1999)
E

Consensus motif: TTTCCCGC
Author: Chaboute ME, Clement B, Sekine M, Philipps G, Chaubet-Gigot N.
Title: Cell cycle regulation of the tobacco ribonucleotide reductase small subunit gene is mediated by E2F-like elements
Reference: Plant Cell 12: 1987-2000 (2000)

Consensus motif: TCTCCCGCC
Author: Ramirez-Parra E, Frundt C, Gutierrez C.
Title: A genome-wide identification of E2F-regulated genes in Arabidopsis
Reference: Plant J. 2003 Feb;33(4):801-11.

Consensus motif: TTTCCCGC
Author: de Jager SM, Menges M, Bauer UM, Murra JA.
Title: Arabidopsis E2F1 binds a sequence present in the promoter of S-phase-regulated gene AtCDC6 and is a member of a multigene family with differential activities.
Reference: Plant Mol Biol. 2001 Nov;47(4):555-68.

Consensus motif: TTCAAGGGGGCATGTATCTTGAA
Author: Solano R., Stepanova A., Chao Q., Ecker J. R.
Title: Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1
Reference: Genes Dev. 12:3703-3714 (1998)

Consensus motif: TTCAAGGGGGCATGTATCTTGAA
Author: Solano R., Stepanova A., Chao Q., Ecker J. R.
Title: Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1
Reference: Genes Dev. 12:3703-3714 (1998).

Consensus motif: TTCAAGGGGGCATGTATCTTGAA
Author: Solano R., Stepanova A., Chao Q., Ecker J. R.
Title: Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1
Reference: Genes Dev. 12:3703-3714 (1998).

Consensus motif: GGATTCAAGGGGGCATGTATCTTGAATCC
Author: Solano R, Stepanova A, Chao Q, Ecker JR
Title: Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1
Reference: Genes Dev. 12: 3703-3714 (1998).

Consensus motif: TAAGAGCCGCC
Author: Shinshi H, Usami S, Ohme-Takagi M.
Title: Identification of an ethylene-responsive region in the promoter of a tobacco class I chitinase gene
Reference: Plant Mol Biol 27:923-932 (1995)

Consensus motif: GCCGCC
Author: Solano R., Stepanova A., Chao Q., Ecker J. R.
Title: Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1
Reference: Genes Dev. 12:3703-3714 (1998)

Consensus motif: AAAATATCT
Author: Harmer SL, Hogenesch JB, Straume M, Chang HS, Han B, Zhu T, Wang X, Kreps JA, Kay SA.
Title: Orchestrated transcription of key pathways in Arabidopsis by the circadian clock
Reference: Science 290: 2110-3 (2000)
G

Consensus motif: CACGTG
Author: Menkens AE, Cashmore AR.
Title: Isolation and characterization of a fourth Arabidopsis thaliana G-box-binding factor, which has similarities to Fos oncoprotein
Reference: Proc Natl Acad Sci USA 91: 2522-2526 (1994)

Consensus motif: (A/T)GATA(G/A)
Author: Teakle GR, Manfield IW, Graham JF, Gilmartin PM.
Title: Arabidopsis thaliana GATA factors: organisation, expression and DNA-binding characteristics
Reference: Plant Mol Biol. 2002 Sep;50(1):43-57.

Consensus motif: CCACGTGG
Author: de Vetten N. C., Ferl R. J.
Title: Characterization of a maize G-box binding factor that is induced by hypoxia
Reference: Plant J. 7:589-601 (1995).

Consensus motif: GCCGCC
Author: Shinozaki K., Yamaguchi-Shinozaki K.
Title: Molecular responses to dehydration and low temperature
Reference: Curr. Opin. Plant Biol. 3:217-223

Consensus motif: TGTGTGGTTAATATG
Author: Green PJ, Kay SA, Chua N-H.
Title: Sequence-specific interactions of a pea nuclear factor with light-responsive elements upstream of the rbcS-3A gene.
Reference: EMBO J 6:2543-2549 (1987)
H

Consensus motif: AGAANNTTCT
Author: Nover L, Bharti K, Doring P, Mishra SK, Ganguli A, Scharf KD.
Title: Arabidopsis and the heat stress transcription factor world: how many heat stress transcription factors do we need?
Reference: Cell Stress Chaperones. 2001 Jul;6(3):177-89. Review.

Consensus motif: CCGTCG
Author: Chaubet N, Flenet M, Clement B, Brignon P, Gigot C.
Title: Identification of cis-elements regulating the expression of an Arabidopsis histone H4 gene
Reference: Plant J 10:425-435 (1996)
I

Consensus motif: GATAAG
Author: Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore AR.
Title: An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene
Reference: Proc Natl Acad Sci USA 85:7089-7093 (1988)
J

Consensus motif: CGTCAATGAA
Author: He Y, Gan S
Title: Identical promoter elements are involved in regulation of the OPR1 gene by senescence and jasmonic acid in Arabidopsis
Reference: Plant Mol Biol 47: 595-605 (2001)

Consensus motif: CATACGTCGTCAA
Author: He Y, Gan S
Title: Identical promoter elements are involved in regulation of the OPR1 gene by senescence and jasmonic acid in Arabidopsis
Reference: Plant Mol Biol 47: 595-605 (2001)
L

Consensus motif: TAAATG(C/T)A
Author: Abe M, Takahashi T, Komeda Y.
Title: Identification of a cis-regulatory element for L1 layer-specific gene expression, which is targeted by an L1-specific homeodomain protein
Reference: Plant J 26: 487-494 (2001)

Consensus motif: CTTAAACCCTAGGGGTAAT
Author: Lamb RS, Hill TA, Tan QKG, Irish VF
Title: Regulation of APETALA3 floral homeotic gene expression by meristem identity genes
Reference: Development 129: 2079-2086. (2002)

Consensus motif: ACGTCATAGA
Author: Despres C, DeLong C, Glaze S, Liu E, Fobert PR
Title: The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors
Reference: Plant Cell 12: 279-290 (2000)

Consensus motif: TCTACGTCAC
Author: Despres C, DeLong C, Glaze S, Liu E, Fobert PR
Title: The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors
Reference: Plant Cell 12: 279-290 (2000)

Consensus motif: ACCGACA
Author: Nordin K, Vahala T, Palva ET.
Title: Differential expression of two related, low-temperature-induced genes in Arabidopsis thaliana (L.) Heynh
Reference: Plant Mol Biol 21:641-653 (1993)
M

Consensus motif: TCTAACCTACCA
Author: Hartmann U, Valentine WJ, Christie JM, Hays J, Jenkins GI, Weisshaar B
Title: Identification of UV/blue light-response elements in the Arabidopsis thaliana chalcone synthase promoter using a homologous protoplast transient expression system
Reference: Plant Mol Biol (1998) 36: 741-754

Consensus motif: (A/C)ACC(A/T)A(A/C)C
Author: Sablowski RWM, Moyano E, Culianez-Macia FA, Schuch W, Martin C, Bevan M.
Title: A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes
Reference: EMBO J 13:128-137 (1994)

Consensus motif: (A/C)TCC(A/T)ACC
Author: Menkens AE, Cashmore AR.
Title: Isolation and characterization of a fourth Arabidopsis thaliana G-box-binding factor, which has similarities to Fos oncoprotein
Reference: Proc Natl Acad Sci USA 91: 2522-2526 (1994)

Consensus motif: TAACT(G/C)GTT
Author: Martin C, Paz-Ares J.
Title: MYB transcription factors in plants
Reference: Trends Genet. 13:67-73 (1997)

Consensus motif: TAACTAAC
Author: Chen W., Provart N. et al.
Title: Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses.
Reference: Plant Cell. 2002 Mar;14(3):559-74.

Consensus motif: A(A/C)C(A/T)A(A/C)C
Author: Chen W., Provart N. et al.
Title: Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses.
Reference: Plant Cell. 2002 Mar;14(3):559-74.
N

Consensus motif: AGATCGACG
Author: Chaubet N, Flenet M, Clement B, Brignon P, Gigot C.
Title: Identification of cis-elements regulating the expression of an Arabidopsis histone H4 gene
Reference: Plant J 10:425-435 (1996)
O

Consensus motif: ATCTTATGTCATTGATGACGACCTCC
Author: Chen W, Chao G, Singh KB
Title: The promoter of a H202-inducible, Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding sites.
Reference: Plant J 10: 955-966 (1996)

Consensus motif: TACACTTTTGG
Author: Chen W, Chao G, Singh KB
Title: The promoter of a H202-inducible, Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding RT
Reference: Plant J 10: 955-966 (1996)

Consensus motif: TGACG(C/T)AAG(C/G)(A/G)(A/C)T(G/T)ACG(C/T)(A/C)(A/C)
Author: Bouchez D, Tokuhisa JG, Llewellyn DJ, Dennis ES, Ellis JG.
Title: The ocs-element is a component of the promoters of several T-DNA and plant viral genes
Reference: EMBO J 8:4197-4204 (1989).

Consensus motif: CGCGGATC
Author: Chaubet N, Philipps G, Chaboute M-E, Ehling M, Giot C.
Title: Nucleotide sequences of two corn histone H3 genes. Genomic organization of the corn histone H3 and H4 genes
Reference: Plant Mol Biol 6:253-263 (1986)
P

Consensus motif: GTGATCAC
Author: Chan CS, Guo L, Shih MC.
Title: Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana
Reference: Plant Mol Biol 46: 131-141 (2001)

Consensus motif: TTGGTTTTGATCAAAACCAA
Author: Chan CS, Guo L, Shih MC.
Title: Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana
Reference: Plant Mol Biol 46: 131-141 (2001)

Consensus motif: TAATTGACTCAATTA
Author: Plesch G., Stoermann K., Torres J. T., Walden R., Somssich I. E.
Title: Developmental and auxin-induced expression of the Arabidopsis prha homeobox gene
Reference: Plant J. 12:635-647 (1997)
R

Consensus motif: CAACA
Author: Kagaya Y, Ohmiya K, Hattori T.
Title: RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants
Reference: Nucleic Acids Res 27: 470-478 (1999)

Consensus motif: CACCTG
Author: Kagaya Y, Ohmiya K, Hattori T.
Title: RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants
Reference: Nucleic Acids Res 27: 470-478 (1999)

Consensus motif: CATGCATG
Author: Dickinson CD, Evans RP, Nielsen NC.
Title: RY repeats are conserved in the 5 prime-flanking region of legume seed protein genes
Reference: Nucleic Acids Res 16:371 (1988)
S

Consensus motif: TNCGTACAA
Author: Cardon G, Hohmann S, Klein J, Nettesheim K, Saedler H, Huijser P.
Title: Molecular characterisation of the Arabidopsis SBP-box genes
Reference: Gene. 1999 Sep 3;237(1):91-104

Consensus motif: AGCCAC
Author: Hudson M, Quail P
Title: Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.
Reference: Plant Physiology.133. 1605?1616. (2003)

Consensus motif: GGGCC
Author: Hudson M, Quail P
Title: Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.
Reference: Plant Physiology.133. 1605?1616. (2003)

Consensus motif: CTCAAGTGA
Author: Hudson M, Quail P
Title: Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.
Reference: Plant Physiology.133. 1605?1616. (2003)

Consensus motif: GTATGATGG
Author: Hudson M, Quail P
Title: Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.
Reference: Plant Physiology.133. 1605?1616. (2003)

Consensus motif: GAGTGAG
Author: Hudson M, Quail P
Title: Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.
Reference: Plant Physiology.133. 1605?1616. (2003)

Consensus motif: TT[AT]TACTAGT
Author: Hudson M, Quail P
Title: Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.
Reference: Plant Physiology.133. 1605?1616. (2003)

Consensus motif: ATAAAACGT
Author: Hudson M, Quail P
Title: Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.
Reference: Plant Physiology.133. 1605?1616. (2003)

Consensus motif: TGTATATAT
Author: Hudson M, Quail P
Title: Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.
Reference: Plant Physiology.133. 1605?1616. (2003)

Consensus motif: CTCCTAATT
Author: Hudson M, Quail P
Title: Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.
Reference: Plant Physiology.133. 1605?1616. (2003)

Consensus motif: TTGCATGACT
Author: Hudson M, Quail P
Title: Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.
Reference: Plant Physiology.133. 1605?1616. (2003)
T

Consensus motif: ACTTTG
Author: Chan CS, Guo L, Shih MC.
Title: Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana
Reference: Plant Mol Biol 46: 131-141 (2001).

Consensus motif: AGGGGCATAATGGTAA
Author: Tremousayque D, Manevski A, Bardet C, Lescure N, Lescure B.
Title: Plant interstitial telomere mitifs participate in the control of gene expression in root meristems
Reference: Plant J 20: 553-561 (1999)

Consensus motif: AAACCCTAA
Author: Tremousayque D, Manevski A, Bardet C, Lescure N, Lescure B.
Title: Plant interstitial telomere mitifs participate in the control of gene expression in root meristems
Reference: Plant J 20: 553-561 (1999)

Consensus motif: TGACGTGG
Author: Schindler U, Beckmann H, Cashmore AR.
Title: TGA1 and G-box binding factors: two distinct classes of Arabidopsis leucine zipper proteins compete for the G-box-like element TGACGTGG
Reference: Plant Cell 4: 1309-1319 (1992).
W

Consensus motif: TTGAC
Author: Yu D, Chen C, Chen Z.
Title: Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression
Reference: Plant Cell 13: 1527-1540 (2001).
Z

Consensus motif: ATACGTGT
Author: Ha SB, An G
Title: Identification of upstream regulatory elements involved in the developmental expression of the Arabidopsis thaliana cab1 gene
Reference: Proc Natl Acad Sci USA 85: 8017-8021 (1988)